Transcript

srsf7a-012

ID
ZDB-TSCRIPT-120702-346
Name
srsf7a-012
Previous Names
  • dkey-85k8.3-012
  • zgc:77155-012
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056181 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056181|OTTDARG00000018399|ZDB-GENE-040426-1798 srsf7a|no_translation DKEY-85K8.3-012 LG_ BX547938.9 Danio rerio protein_coding KNOWN, 875 bp
GACGGGTGACGCTTCCGGGACAAGAACGCAAGTAGCATGA
GATAAGAGAATCGCCGTTTCCTCCTTTCAGCCAAGGTTTG
GTTGAAGCGCCTTTAATCAACCGGAAGAAGAAGACGTTCA
CGCGCCCTCACACGGAACCGAGGACGTCGAGTCACACAGT
GCAAGATGTCATACTCATCCCGGAGTTCCTCTCGCACCTC
TGACTGTAAGGTCTATGTGGGTGACCTTGGTAATGGTGCA
GCCAAAGGTGAGCTGGAACGAGCCTTCAGTTACTACGGGC
CATTAAGGAGTGTATGGGTCGCCCGGAACCCTCCAGGTTT
CGCCTTCGTAGAGTATGAGGATGCCAGAGATGCAGAGGAT
GCCGTAAAGGGGATGGATGGAAAGGTGCTTTGTGGAGCCC
GTGTCAGAGTTGAGCTGTCTAATGGTATGTCCAGAAAGTC
CCGTTATGGCCGTCCCAGCCGCAGGCAATTTGACCCCAAT
GACCGCTGTTACCAGTGTGGGGAGACAGGTCATTATGCCT
ACGACTGCTATCGTTTCAGCAAGAGGCGAAGCAGACGCAG
CAGGTCAGGATCTCGTTCCCGGTCCAGATCTCGTGGTCGC
CGCTACCGCTCTCGTAGTCGTAGCAATGAAAGGCAAGTCT
TGTTACCGCTTGGCTGTGTTTCAAATGCTTTGCAGTTATG
AATTTTATGTAATCTTATTTTTTTCAGGAGGTACCGTTCA
CCTTCATACTCGAAACGCAGAAGCAGGTAAGCCCTCAGTC
AGTGCCTGTTTCTGCCAGGGTCCGAACAAAATGAGCAAAG
ATTTCCCATCGTATTCAAGATAAGAAGGCTAAAATGCCCA
TACAGGCTTGAACAAGATCACAGCTTTTTTATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations