Transcript

srsf7a-211

ID
ZDB-TSCRIPT-090929-5679
Name
srsf7a-211
Previous Names
  • srsf7a-010
  • zgc:77155-010
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022318 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022318|OTTDARG00000018399|ZDB-GENE-040426-1798 srsf7a|OTTDARP00000044055 DKEY-85K8.3-010 LG_ BX547938.9 Danio rerio protein_coding KNOWN, 724 bp
GCAAGTAGCATGAGATAAGAGAATCGCCAAGGTTTGGTTG
AAGCGCCTTTAATCAACCGGAAGAAGAAGACGTTCACGCG
CCCTCACACGGAACCGAGGACGTCGAGTCACACAGTGCAA
GATGTCATACTCATCCCGGAGTTCCTCTCGCACCTCTGAC
TGTAAGGTCTATGTGGGTGACCTTGGTAATGGTGCAGCCA
AAGGTGAGCTGGAACGAGCCTTCAGTTACTACGGGCCATT
AAGGAGTGTATGGGTCGCCCGGAACCCTCCAGGTTTCGCC
TTCGTAGAGTATGAGGATGCCAGAGATGCAGAGGATGCCG
TAAAGGGGATGGATGGAAAGTGAGTCAACTTGAGTTCTAC
CTGCCTACATTTGATGATGCTACTGCTGCACATTTAACAC
CCTGACCACTTCAGGGAGCTCAGACCCGCAGGGGGTGCTT
TGTGGAGCCCGTGTCAGAGTTGAGCTGTCTAATGGTATGT
CCAGAAAGTCCCGTTATGGCCGTCCCAGCCGCAGGCAATT
TGACCCCAATGACCGCTGTTACCAGTGTGGGGAGACAGGT
CATTATGCCTACGACTGCTATCGTTTCAGCAAGAGGCGAA
GCAGACGCAGCAGGTCAGGATCTCGTTCCCGGTCCAGATC
TCGTGGTCGCCGCTACCGCTCTCGTAGTCGTAGCAATGAA
AGGCAAGTCTTGTTACCGCTTGGCTGTGTTTCAAATGCTT
TGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations