ZFIN ID: ZDB-TSCRIPT-120213-684
Transcript Name: si:ch211-173p18.3-007
Previous Name: ch211-173p18.3-007

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054334 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054334|OTTDARG00000015420|ZDB-GENE-060503-672 si:ch211-173p18.3|no_translation CH211-173P18.3-007 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 845 bp
GTCCCTTTCACACCTCAGAGACCATTGCGCTTCTCAGAGA
GCAAATGGAAAATGATTCTGGAAAACGGAGATCTTGCAAG
AAAGGACCTGATGTCTCAACTCAGAAGAAACGGGGTCGTA
AGTGTGCGTCTGTTCCTTCAAACATCCTCTCCAAACTGCA
ACACGAGTACGGCGTCAAGGCCTGGAGGGACTGGGTACGC
TGGAAAAACGCCCAACCCAACTCGGATGCTCCTAAATTTG
GCTCACGCAGCATGACACTAAAGGAGGACGTGTTGAAGTG
TTGCACGGCAGAATTAAGCTACGGTCTCTGTAAGTTTATC
ACTGAAGTCCGGCGACCCAATGGAGAGAAATACAGTCCTG
ACAGCATCTATTACCTCTGCTTGGGCATCCAGCAGTACCT
GTTTGAGAACAATCGGATGGAGAACATCTTCTCAGATGTC
TTCTACACTAAATTCTGCTGGGAAATGAGCAACATACTCA
AGGGGTGGAAACCAACTATTCTGCCTAATGGTTATATTCA
CTCTCGTGTGGAAGAGGAGTTTCTGTGGAACTGTAAGCAG
CTCGGGGCCTTTTCACCTGGCGTTCTGCTCAACACTTTAA
TCTATTTCTTCACAAAGTACTTTAACTACAGGACCGTGGA
GCAGCACCGTCTCCTCTCTTTCGCACACGTCAAACGTTAC
ACTCGGGGGCCGGCCAACGCTAAAGTGTCCTTCCTGCGTT
TCTACCCACCAAAAGAGGACTCAAGCGACGATGGTGTCCC
TGCAAAGAAAAGAAAGAAGGACGATGAACGACAAAGGGTG
CTTAAGATAGGGCAGAATTCAGACAATCCCCTCCATTGTC
CCGTC

si:ch211-173p18.3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-173p18.3-202 (1)    Ensembl 727
si:ch211-173p18.3-203 (1)    Ensembl 5133
si:ch211-173p18.3-206 (1)    Ensembl 784
ncRNA si:ch211-173p18.3-003 (1)    Ensembl 755
si:ch211-173p18.3-005 (1)    Ensembl 583
si:ch211-173p18.3-007 845
si:ch211-173p18.3-008 (1)    Ensembl 917
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-173p18.3-007 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000054334 (1),  Ensembl_Trans:ENSDART00000151242 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT728363 (1) 845 nt
CITATIONS (2)