Transcript

si:ch211-173p18.3-008

ID
ZDB-TSCRIPT-120213-1069
Name
si:ch211-173p18.3-008
Previous Names
  • ch211-173p18.3-008
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000054332 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054332|OTTDARG00000015420|ZDB-GENE-060503-672 si:ch211-173p18.3|no_translation CH211-173P18.3-008 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 917 bp
CTGCTTCTGTCAAAGCGAACTCCCATTTGACACACCTCAA
AGCTCATAAAAAGACAAATTCATTGCATTTTAAGTAGATA
TCTTGACATCTCCTTTCGAACGTGTTTTCGCTTCTGCCCG
TCTAAACATGGCGGCTTTACGTTCCGTTTAATAGATTTGT
TTTCTGAAATGGTCCGCGTGTGCGATTTTTTTTTTCCTGG
TTCTAACAAAGAAAAAGCAATACGACTCCATCTAGCAGCT
GAAGCGGTGGCTGCGCTCTCTTAAACTGGATATAAGATCA
GTCCGGGCGCTGAGGGTGTGCAGTGAACATTTTACACCAG
ACGATCTGGCAGGACCAACTCGACGAAAACTAAAACCCAA
CAACAAACGGAGGAGACTGAGATTGATCCAGAAAGCCAAT
CAATTGATGACAGCTTTGATTTTGAAGATGAAGAGGCATA
TTTTGATGATGATGATGATATTCAGTCAACTGTAGGAAGG
CAAAAGAACCCCAGATCCTGCCCTGGTGAACGTCTTCAGT
CCAGACTCATTTTAACCGTTACAAATCCATCTACTGAACC
AACCACACCTCCATCTGTATTTGGCACCTATTATGCTCTT
TCTCCCACGTGGTACTACCAAATGGTAAATCCTCTCATCC
GCTTGTTAAGTCTGACATCACGCGAAGAAGCTTCCGGGTC
TAATCGCTCTATCGATCTGTAAGGGGAGGCTCAATAAATG
GAACAATTTAAATCACGATCGCAATATATATCTATGCCTA
ATATCAGATAGCCAGAAAGTGCTACATTTTTATAAATAGT
TAAAACTATTGATGTCTAAGATGCTGCAAGTCCAGAAACA
GTTGTGTACTCCACGATTTTCTAAAAAAAAAATCACTTTA
ATGTGTGATATGACTAAAAAGGGGTCATAAACTAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations