Transcript

si:ch211-173p18.3-003

ID
ZDB-TSCRIPT-120213-299
Name
si:ch211-173p18.3-003
Previous Names
  • ch211-173p18.3-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000054333 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054333|OTTDARG00000015420|ZDB-GENE-060503-672 si:ch211-173p18.3|no_translation CH211-173P18.3-003 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 755 bp
AGGAGACTGAGATTGATCCAGAAAGCCAATCAATTGATGA
CAGCTTTGATTTTGAAGATGAAGAGGCATATTTTGATGAT
GATGATGATATTCAGTCAACTGTAGGAAGGCAAAAGAACC
CCAGATCCTGCCCTGGTGAACGTCTTCAGTCCAGACTCAT
TTTAACCGTTACAAATCCATCTACTGAACCAACCACACCT
CCATCTGTATTTGGCACCTATTATGCTCTTTCTCCCACGT
GGTACTACCAAATGGATGATCCTTCAAAGATTGGACTACA
CATGGAAGAACCGTTCAATGAAAACGTCAACATGGATTTT
GTTGCTAATAAAGAAGCTGGTGGCTTTTTGAACCATGAGC
TTTCCAAAGGACATTCACATGTGTGTCGGAGAAGCAGACC
AGAAAAAAGAAATCCATTAAGCCAGGATAGAGGATCTAAA
AGAAGTGCACCGGGATCGCCAGAGGATGCCACGGATTCAG
ATAATGAGGACAAAGACATCAACACAGAAGAAAATGCACA
GTGTTCAGAAGAGCTAGTGATCACTAAAGTCGAGGACCTC
TCAAATGAAACCGAATTTGATCAGAATGAGAATTACAGTG
GGAAAATGGACATGGACGAACCAGAAGATTCAGGTAAATG
ATTAACGCTGACACCATTACAGGTCCATCAGTTACCCAGA
TTATTTAAAGAACCCCTATTGTGCATTAAAAAAGGTTTTG
GGGGTCTCCAATAACAGGGTGATATGCATGCAAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations