ZFIN ID: ZDB-TSCRIPT-090929-4096
Transcript Name: si:ch211-173p18.3-203
Previous Name: si:ch211-173p18.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018477 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018477|OTTDARG00000015420|ZDB-GENE-060503-672 si:ch211-173p18.3|OTTDARP00000015600 CH211-173P18.3-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 5133 bp
TGGTCTAATTCGATTCAATGATCTATGCTAAGCTAACATG
AAAATGCTTCCGCCTGACCCATATATCAGTTGAAATTATT
CAAAATTGTAAAGCTCTACTGTTTAACTCCGGGGCAGTTG
TAAAATAAGCCTATTTCCAAAAAAAGTGGTCCTGCATTAC
GACCCCAGTCCACTAGGTGGGGCAAATGCATCAAATTTTG
TTTTGTAAACATCCGCTAGAAGGATTTTTTTCCATATAAA
AGTGGATGACTGCTTCTGTCAAAGCGAACTCCCATTTGAC
ACACCTCAAAGCTCATAAAAAGACAAATTCATTGCATTTT
AAGTAGATATCTTGACATCTCCTTTCGAACGTGTTTTCGC
TTCTGCCCGTCTAAACATGGCGGCTTTACGTTCCGTTTAA
TAGATTTGTTTTCTGAAATGGTCCGCGTGTGCGATTTTTT
TTTTCCTGGTTCTAACAAAGAAAAAGCAATACGACTCCAT
CTAGCAGCTGAAGCGGTGGCTGCGCTCTCTTAAACTGGAT
ATAAGATCAGTCCGGGCGCTGAGGGTGTGCAGTGAACATT
TTACACCAGACGATCTGGCAGGACCAACTCGACGAAAACT
AAAACCCAACAACAAACGGAGGATGATCCTTCAAAGATTG
GACTACACATGGAAGAACCGTTCAATGAAAACGTCAACAT
GGATTTTGTTGCTAATAAAGAAGCTGGTGGCTTTTTGAAC
CATGAGCTTTCCAAAGGACATTCACATGTGTGTCGGAGAA
GCAGACCAGAAAAAAGAAATCCATTAAGCCAGGATAGAGG
ATCTAAAAGAAGTGCACCGGGATCGCCAGAGGATGCCACG
GATTCAGATAATGAGGACAAAGACATCAACACAGAAGAAA
ATGCACAGTGTTCAGAAGAGCTAGTGATCACTAAAGTCGA
GGACCTCTCAAATGAAACCGAATTTGATCAGAATGAGAAT
TACAGTGGGAAAATGGACATGGACGAACCAGAAGATTCAG
AAGCACTGAGGGCCAAAGGCCTTAAAAGCAGACCTGCACA
TTCATCTGCTGTCACGCAAACGCAGGCTGCTGATAAAAGA
TTTGCAGGATTTGACCCCTCTGACGTTTTACCTGTGAAGA
TCAAAGATGAACCGATGGATGAAGAGTGGAAGAAAGCACC
TCAAAGTCCACTGAGAAGCATTAAAGATGATGAGGATTTT
GACCAACAGAGGCTCGGATCTTATCATCAGGTGCCTGGTG
TAAATAATGCATCCACTGGAGCACAAACGGAGTCCATTCA
GAATTTCAAGCGACTTGGTGTTCTGTGCACTGCCTGCAAT
AAGGTCTTGCTGAAGGGACAAACAGCCTTCCAGCGCAGTG
GCTCTGCTAAAATCTACTGCTCACTTGAATGTCTCCGGAG
CACCAAGAATAAAGCATGTCACCACTGCCTCAAAGAGATT
CATGAAGACAGCAGCATCATAGTTGCCCCAGTGGACATGT
CAGGGGCTGGGAAGGAGTTTTGCAGTCAGAAATGCCGCAA
CGCTTTAACTTTTAAGTGCAGTGTGTGTCAGAAGGCAGGA
ATAAGACACGTTCATGAGGTGAACTTCAGAGGCTCCATTC
AAAAGCTGTGCAGCGATGGCTGCTTCAACCAGTTCCGCTC
CTCCAATAAGCTGAACATGAACAGCTGTGTGAACTGTGGA
GGATTCTGCTATGGCACAGACGCTCAGTGTCCATCTCTGC
GCATGGAAGACAGAGTTATGAAGTTCTGCAGCCAAACCTG
CCTTACAGCTTACAAAAAGAGGAGCCTGAAACTTGTCACC
TGTAAGACGTGTCATGCCCTGAGGCCTGCGGAAGATGCAC
TGGACAGTCCAAACGCAGAGGGAATCCGGGAGCTTTTCTG
CTCTGTCTCCTGTGTCACTGCGAGTAAAGATCAGACCGTG
GGTTTGTCAGCTGCTCCAGTGGAATGCAACAACTGCAAGC
TGAAACTAGTGCCTCAGTACCACATAGCCATGTCTGAAGG
ATCCGTTCAAAACTTCTGCACATTCTCCTGCGTAGTAGCA
TATCAGGAATCCTTGAATAATAAAAAAGCGAACACACAAG
TGAACACCGTAACCTCTACAAGCAGCAACACAACTACTGC
AGCAAAAACTGCTGCCCCCAAACCTGCTTCATCGGAGTCC
AGCTCAGCAGCCAAGACTAGCACCCCTAGTGGTCAAGGCC
AAAACGTCACTAAAATCCCCTGCTGTCAGTGTCTGAACGC
CTTCTTCCACAAGCCAGAACTGATGGAGTATAAGAGGAAA
ATGTACGCTTTCTGTGGCAACGATTGTATCGATGAGTTCA
GAAAGGTCAACCGTGTGGTGGCTCGCTGTGAAAACTGCAA
CCTCAATAAAAGAGTCAAAGTCGTGAGAAGGATAAACAGA
GTTGACCGCTCTTTCTGCGAAGAGAAATGCAGGGCACTCT
TTGAGCAGAACCTGGTCAAGCGTTGGGGGACAAAGCACTG
TAGCAATTGTTTCCACTGTAACAGCACTTCTAAGACTGTA
GTGACGGAAGTCTTCAATGGCAAACAGGAGGAGTTCTGTG
GGAGCGATTGCTTGTCACAACATAATTTACTGATTCGTCA
GGAAATAAAGTGCTCAATGTGCAGACAGATCAAGAAGATG
AACGAGTCTGTGAAATGGCTGGGAGAGATGAAGCACTTCT
GCAGCCTGCGGTGCCTGATGTTTTTCTGCAGTCTGCAGGG
CATCACTGGAGCCGTCATCAAGGCAACCAGCAAATCTCTG
GCCACACAGTGTGCAAAGCCAATGTCATCTGCAGTCACAC
AGAAGCCTAAAGAGGCCACGCCGGTCATTGCCAGTGTCGT
TTCACTTTCAGGGCCATCCAGCAAACAGCCAGGCGTTTCA
GGAAACACGAATGCGAAAGGCTCTGTTCAAACAGATGTGA
CCATGAAGCATAAACGTAATCTGAGATCCCAAATCCTACA
GAACAAATCCCCAAGCAAAAACAAATCCACAACCTGTAAA
CCCCACACCGCTGATGCTGAGATACAGAAAGATGAGGCAC
CTAAAGTGATAGTGCTGCCTGTTCCGGTGCCAGTCTATGT
GCCAGTTCCCATGAATCTCTACTCTCAATATGTTCCAAAG
TCTGTTGGGATGCCCCTTCCGGTTCCAGTGCCCTTGTTCT
TCCCCACGACTCTGGACAGCGCCGAACACATTGTACAGAC
CATTCAGGAAATCAAAGAGAAGATCCCTGATGATCCTCTG
GAGGCCGACCTCATCATGATGGCGGAGATGGTGGCGGAGG
ATGCAGAGAAGGAGAAACACATCAGCTCCTGTGATCAGAC
TGATAACATTATGGAGGATCTCGATTTGCAAGATCTGTCT
AGTAATCTGAGCTGGGAGGAGGATCCTGTGTCTCCTGCTC
AAATTTTGGATCAAACCCCAGAACCTGAACCACCACCACC
ACCACCTCCTCCTGCTCCTGCTTCTACTCCTACTCCTACT
TTTGCTCCTGCTTCTACTCCTACTTTTGCTCCTGCTTCTA
CTCCTACTCCTACTTTTGCTCCTGTTTCTACTCCTACTTT
TGCTCCTGCTCCATCATCCAGATCTGCCACAATGACACTC
GTCTCCACCAAAGCAGGGGAGCCACTGATGGACTTGGAGG
CGGATTTCCCAATTGAGACCATTGCGCTTCTCAGAGAGCA
AATGGAAAATGATTCTGGAAAACGGAGATCTTGCAAGAAA
GGACCTGATGTCTCAACTCAGAAGAAACGGGGTCGTAAGT
GTGCGTCTGTTCCTTCAAACATCCTCTCCAAACTGCAACA
CGAGTACGGCGTCAAGGCCTGGAGGGACTGGGTACGCTGG
AAAAACGCCCAACCCAACTCGGATGCTCCTAAATTTGGCT
CACGCAGCATGACACTAAAGGAGGACGTGTTGAAGTGTTG
CACGGCAGAATTAAGCTACGGTCTCTGTAAGTTTATCACT
GAAGTCCGGCGACCCAATGGAGAGAAATACAGTCCTGACA
GCATCTATTACCTCTGCTTGGGCATCCAGCAGTACCTGTT
TGAGAACAATCGGATGGAGAACATCTTCTCAGATGTCTTC
TACACTAAATTCTGCTGGGAAATGAGCAACATACTCAAGG
GGTGGAAACCAACTATTCTGCCTAATGGTTATATTCACTC
TCGTGTGGAAGAGGAGTTTCTGTGGAACTGTAAGCAGCTC
GGGGCCTTTTCACCTGGCGTTCTGCTCAACACTTTAATCT
ATTTCTTCACAAAGTACTTTAACTACAGGACCGTGGAGCA
GCACCGTCTCCTCTCTTTCGCACACGTCAAACGTTACACT
CGGGGGCCGGCCAACGCTAAAGTGTCCTTCCTGCGTTTCT
ACCCACCAAAAGAGGACTCAAGCGACGATGGTGTCCCTGC
AAAGAAAAGAAAGAAGGACGATGAACGACAAAGGGTGCTT
AAGATAGGGCAGAATTCAGACAATCCCCTCCATTGTCCCG
TCAGGCTTTACGAGTTTTATCTCTCAAAATGCTCGCCTGG
CATTAGGCATCACGCAACCAAGTTTTACCTGAGCCCCGAG
CGCTCCTGTGTTCCCAGCAGCCCTACATGGTTCTCCATCA
GCGCTCTGAGCGACGAGGCTCTGGACAGCATGTTATCCCG
CATCCTCACAGTCCGAGAGCTTCATATGGAGACAGAGCAA
ACACCCGCTGACACTGATTCAGACAGCGACTCTGACTACA
ATCAGTTTTAAGACCACAAACCTGAGCTCGTCCTCTGAAG
TAGTTCTGGAAAGCAAGCGGTTTGTTATTGTGTCCGTTGT
TGTTCATTCTCAGTTATCTATTACTGGCTCTAGATACCTA
TATGTCTTGTTCCCCGACATCTTTCATTTTTTCAAAGTTT
CTTCCGGATGTCCAGGATGCTTGAACTCCTCCAGCGGTGG
ACGCTGATCACTCATTAAACTCATTATTGTAAGTCACCAC
AATTTGTATTCTATCGATACACTAAAGACATTGGCAGCAT
CATTCCAAAAGAACACTATTTTGACATTGCTGTTCTTCAT
CGCAAACCATATTAGTATGTATTGAATGAATGTTCCCAAA
ATTATGGATGTTATTGCTTTTTTGTTTTTATGGATAAAAC
ACTACGAAACTAA

si:ch211-173p18.3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-173p18.3-202 (1)    Ensembl 727
si:ch211-173p18.3-203 5133
si:ch211-173p18.3-206 (1)    Ensembl 784
ncRNA si:ch211-173p18.3-003 (1)    Ensembl 755
si:ch211-173p18.3-005 (1)    Ensembl 583
si:ch211-173p18.3-007 (1)    Ensembl 845
si:ch211-173p18.3-008 (1)    Ensembl 917
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-173p18.3-203 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000018477 (1),  Ensembl_Trans:ENSDART00000143966 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091551 (1) 1582 nt
GenBank:EH997465 (1) 1055 nt
GenBank:EE694545 (1) 962 nt
GenBank:EE330648 (1) 820 nt
GenBank:AI959741 (1) 663 nt
GenBank:EB916954 (1) 585 nt
GenBank:CD606582 (1) 319 nt
CITATIONS (2)