ZFIN ID: ZDB-TSCRIPT-120213-683
Transcript Name: si:ch211-173p18.3-206
Previous Names: ch211-173p18.3-002, si:ch211-173p18.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054331 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054331|OTTDARG00000015420|ZDB-GENE-060503-672 si:ch211-173p18.3|OTTDARP00000042682 CH211-173P18.3-002 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 784 bp
ATCCGCTAGAAGGATTTTTTTCCATATAAAAGTGGATGAC
TGCTTCTGTCAAAGCGAACTCCCATTTGACACACCTCAAA
GCTCATAAAAAGACAAATTCATTGCATTTTAAGTAGATAT
CTTGACATCTCCTTTCGAACGTGTTTTCGCTTCTGCCCGT
CTAAACATGGCGGCTTTACGTTCCGTTTAATAGATTTGTT
TTCTGAAATGGTCCGCGTGTGCGATTTTTTTTTTCCTGGT
TCTAACAAAGAAAAAGCAATACGACTCCATCTAGCAGCTG
AAGCGGTGGCTGCGCTCTCTTAAACTGGATATAAGATCAG
TCCGGGCGCTGAGGGTGTGCAGTGAACATTTTACACCAGA
CGATCTGGCAGGACCAACTCGACGAAAACTAAAACCCAAC
AACAAACGGAGGAGACTGAGATTGATCCAGAAAGCCAATC
AATTGATGACAGCTTTGATTTTGAAGATGAAGAGGCATAT
TTTGATGATGATGATGATATTCAGTCAACTGTAGGAAGGC
AAAAGAACCCCAGATCCTGCCCTGGTGAACGTCTTCAGTC
CAGACTCATTTTAACCGTTACAAATCCATCTACTGAACCA
ACCACACCTCCATCTGTATTTGGCACCTATTATGCTCTTT
CTCCCACGTGGTACTACCAAATGGATGATCCTTCAAAGAT
TGGACTACACATGGAAGAACCGTTCAATGAAAACGTCAAC
ATGGATTTTGTTGCTAATAAAGAAGCTGGTGGCTTTTTGA
ACCATGAGCTTTCCAAAGGACATT

si:ch211-173p18.3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-173p18.3-202 (1)    Ensembl 727
si:ch211-173p18.3-203 (1)    Ensembl 5133
si:ch211-173p18.3-206 784
ncRNA si:ch211-173p18.3-003 (1)    Ensembl 755
si:ch211-173p18.3-005 (1)    Ensembl 583
si:ch211-173p18.3-007 (1)    Ensembl 845
si:ch211-173p18.3-008 (1)    Ensembl 917
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-173p18.3-206 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000054331 (1),  Ensembl_Trans:ENSDART00000151276 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH450704 (1) 813 nt
CITATIONS (2)