Transcript

dmd-008

ID
ZDB-TSCRIPT-091110-507
Name
dmd-008
Previous Names
  • ch211-227l2.4-001
  • ottdart00000044469
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044469 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044469|OTTDARG00000031909|ZDB-GENE-010426-1 dmd|no_translation dmd-008 LG_none BX323090.7,BX004756.8,BX323020.9 Danio rerio protein_coding KNOWN, 780 bp
CAGGCTAGCTGAAATGGAGAACCGAAATGGCTCGTATGTG
AATGACAATGTATCGCCCAATGAAAGCATGGATGATGAGC
ATCTGCTGATCCAGCACTACTGCCAGAGTCTGAATCAAGG
CTCTCCTCTCAGCCAGCCGCAGAGCCCCGCTCAGATCCTC
ATCTCAATGGAGACTGAAGAGAAGGGAGAGCTGGAGAGAG
TGCTCAATGATCTGGAGCAGGAAAACAGGAAGCTGCAAGC
GGAGTACGATCGTCTGAAAAAGGCACACGATCACAAGGGT
CTGTCACCGTTGCCTTCACCTCCACAGATGCTTCCGGTGT
CGCCTCAAAGTCCACGCGACGCAGAACTAATCGCAGAAGC
CAAACTACTGCGGCAACACAAGGGACGATTGGAGGCAAGA
ATGCAAATCCTGGAGGATCACAACAAGCAGCTGGAATCGC
AGCTTACACGCCTAAGACAGTTACTCGAGCAGGTGATGAT
GAGCTGTCCAGTCCCACCCAGGATGCAAGCACTGGATTAG
AAGACGTCATCGAGCAGCTCAACAACTCCTTCCCTCACAG
CCAAGGAGGCGGACGGCTAAATCCATGAGAGGTCCCAATG
TGGGAAGTCTTTTCCACATGGTTGATAACATTGGACATGC
CATGGAGTCGCTGGTTCATGTAATAACAGAGGAGCAGGAT
TTAGACTGAAGACGTCTTCTCCTCGTTGCATGCTTTTGTA
GTGTCAACAACTGGACCGGATATGTTTACAATGGGGAATA
TCAATAAAAATCTATTTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations