header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1236
Transcript Name: dmd-006
Previous Names: ch211-161h7.6-001, ottdart00000044467

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044467 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044467|OTTDARG00000031909|ZDB-GENE-010426-1 dmd|no_translation dmd-006 LG_none BX323090.7,BX004756.8,BX323020.9 Danio rerio protein_coding KNOWN, 708 bp
GGATGCGCTTGTGGATTAGTTAGTGTAGAGGAGAAACCGT
CACACTCCACAGGTGCATGAGCTTTCAGAAGAGAGCTGGG
TGCCAAAGAACCTGTAATCAATGGAACTCTCGACAATGCG
AAAACCTTCCTTGCTGAGATGCCTCGTGAGGGCCTGAAAC
AGAGACCTGGACAAAAAGATGTAAGTCCTGAGGAGCGGGT
TCAAAACGTGGGCCGCATATTGCGTAAAGAAGTGGAGGAT
GTAACGGTGCGATGGAAGAATCTGGGTGCAGCTTCTGTGG
ACTGGCAGCAACAGCTGGAACTGGCCTTGGAGAGGCTGAT
GGAGCTCCAGGACGCCCAGGATCAGCTGGACTACAAGCTA
CGACAGGCTGAGAGCGTGAAGAATTCTTGGAAGCCTGTTG
GGGAGCTGCTTGTAGACGATTTGCAAAACCACATAGACAG
AGTGAAGGCATTTCAGGAAGAGATAGCTCCCATTCAGGAT
AACGTAAATCATGTTAACCAGCTGGCCTCCACATTTAGAC
CGTCTGACATTCAGCTTTCTCCAGACAACCTGAGCAGAAT
CGATGACCTCAACATGAGATGGAGGCTTCTGCAGATCTCC
ATTGAGGAGCATCTGAGTCAGCTGACCACAGCCTTTAAGG
ACTTGGGACCCTCTCAGAATTTCCTTCATGCGTCTGTTGA
AAGCCCTCTCGAACGCTCTATTTCACCC

dmd TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dmd-201 (1)    Ensembl 3488
dmd-202 (1)    Ensembl 2163
dmd-203 (1)    Ensembl 11030
dmd-205 (1)    Ensembl 1196
dmd-209 (1)    Ensembl 722
dmd-211 (1)    Ensembl 579
ncRNA dmd-005 (1)    Ensembl 696
dmd-006 708
dmd-007 (1)    Ensembl 676
dmd-008 (1)    Ensembl 780
dmd-009 (1)    Ensembl 530
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dmd-006 Contained in:

Genome Resources: Vega_Trans:OTTDART00000044467 (1), Ensembl_Trans:ENSDART00000144095 (1)
PROTEIN PRODUCTSNo links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DR725526 (1) 744bp
CITATIONS (2)