Transcript

dmd-211

ID
ZDB-TSCRIPT-091110-1956
Name
dmd-211
Previous Names
  • dmd-009
  • dmd-010
  • ottdart00000044471
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044471 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044471|OTTDARG00000031909|ZDB-GENE-010426-1 dmd|OTTDARP00000035152 dmd-010 LG_none BX323090.7,BX004756.8,BX323020.9 Danio rerio protein_coding KNOWN, 579 bp
TGAAAAAGGCACACGATCACAAGGGTCTGTCACCGTTGCC
TTCACCTCCACAGATGCTTCCGGTGTCGCCTCAAAGTCCA
CGCGACGCAGAACTAATCGCAGAAGCCAAACTACTGCGGC
AACACAAGGGACGATTGGAGGCAAGAATGCAAATCCTGGA
GGATCACAACAAGCAGCTGGAATCGCAGCTTACACGCCTA
AGACAGTTACTCGAGCAGACTGAGTCCAAGGTGAATGGCA
CTGCCCTGTCCTCACCCTCCACTGCCTCTCCGAGATCTGA
CACCAGCCTGGCCTCACTGCGTGTGGCCGCAAGCCAAACC
ACAGAGACCATGGGTGATGATGAGCTGTCCAGTCCCACCC
AGGATGCAAGCACTGGATTAGAAGACGTCATCGAGCAGCT
CAACAACTCCTTCCCTCACAGCCAAGGAGGCGGACGGCTA
AATCCATGAGAGGTTAGTATTGTAACTAACCTTTCAGTCT
TCTCACTCGTCTTTTCAGCCTTTCTTGTCTATTTAAACTG
TGATTTCAGGAAGCTTTTTAAAGAGTATTATTAAAAATGT
ATGTTTTCAGTTAGCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations