ZFIN ID: ZDB-TSCRIPT-091110-1955
Transcript Name: dmd-007
Previous Names: dmd-006, ottdart00000044468

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044468 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044468|OTTDARG00000031909|ZDB-GENE-010426-1 dmd|no_translation dmd-007 LG_none BX323090.7,BX004756.8,BX323020.9 Danio rerio protein_coding KNOWN, 676 bp
GAGGAAAAGCTCCGCCTCGTCTGAACCGCTTTGGCTGAGG
GAGATCGCAGGGAAGTCGGATGCTTTTTCCACAGTAGAGA
GGGAACACCGCGGAGGTGATTCGCCCCCAAAACAACACCG
AGCCATCGGGATTTTTAAAAAAGGAACACTTTGGATTCGG
CGTTTTCTGGGAGGCGAGATGAGGGAGAACTTGAGAAATC
ACCAGACCCAAACAACATGTTGGGACCACCCAAAGATGGC
AGAACTCTACCAGTCATTAGCGGATCTCAACAACGTGCGG
TTCTCGGCATACAGGACGGCAATGAAGCTCAGACGAATGC
AGAAAGCCCTCTGTTTGGATCTTCTGAGCATGCCTGCAGC
CTGTGAAGCCTTTGAGCAGCACAATCTCAAACAGAACGAG
CAGTTCATGGACATCGTGCAGGTGATCAACTGTCTGACCA
GCATCTACGACCGTCTGGAGCAGCAGCACAGCAGCCTGGT
CAACGTGCCTCTCTGTGTGGACATGTGTCTCAACTGGCTG
CTCAACGTTTACGATACGTACGTTTGACCCGTTTATTATT
GTTGCTTTGCTTGTTTAAACGGCTCCCTTTTTACAAGAGG
TAAAATAAGACTTTTGTGTTTCCAGAATGTGGCTGTAAAG
TTTCAAACCGAAATGCAAATTAGATCATTTATTATA

dmd TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dmd-201 (1)    Ensembl 3488
dmd-202 (1)    Ensembl 2163
dmd-203 (1)    Ensembl 11030
dmd-205 (1)    Ensembl 1196
dmd-209 (1)    Ensembl 722
dmd-211 (1)    Ensembl 579
ncRNA dmd-005 (1)    Ensembl 696
dmd-006 (1)    Ensembl 708
dmd-007 676
dmd-008 (1)    Ensembl 780
dmd-009 (1)    Ensembl 530
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dmd-007 Contained in:

Genome Resources: Vega_Trans:OTTDART00000044468 (1),  Ensembl_Trans:ENSDART00000131744 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH545178 (1) 732 bp
CITATIONS (2)