header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-504
Transcript Name: dmd-203
Previous Names: dmd-001, dmd-004, ottdart00000044458

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044458 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044458|OTTDARG00000031909|ZDB-GENE-010426-1 dmd|OTTDARP00000035146 dmd-001 LG_none BX323090.7,BX004756.8,BX323020.9 Danio rerio protein_coding KNOWN, 11030 bp
ATTCACAAAAAATTCACTGCTGGATCTGAGGTTCAGTTTG
TTCACAGGGCGTTGGTGAGGGCTCCTTCCTTTTTCTGTTT
ATAAAATTGTAGGATTAAAGGACTCCACGTTCGCTTGGAT
CTTATGTCATGGCCGAAGCAGTGAACCCACAGGACCAATG
GGAGGAAGGTTTTGAGGACGAATTCGGAGAAATCATCAAA
ACTCGATCAGATGAAAGAGAAGACGTTCAAAAGAAAACCT
TCACCAAATGGATAAACTCACAGTTTGCTAAGACAAGAAG
ACCTCCTATTGATGACCTCTTCACTGACCTGTGTGATGGC
CGACGTCTTCTTGAACTTCTGGAGGTTCTGGTTGGCCATG
AAATAGTTAAAGAACGTGGCTTCACTCGAGTGCACTCCCT
TAACAATGTTAACAGGGCCCTGCAGATCCTTCAGAAGAAC
AATGTTGATCTGGTGAACATTGGAGGAGCTGACATTGTAG
ATGGGAATCATAAACTGACCCTGGGGCTCATCTGGAGCAT
CATTCTCCACTGGCAGGTTAAGGATGTGATGAAAGATGTC
ATGGCGGACTTACAGCAGACCAACAGCGAAAAGATCCTGT
TAAGCTGGGTCAGGCAGTCCCTCAAAAACTACCAAGACGT
CAACGTGGTCAACTTCTCCAGCAGCTGGGCCGACGGTTTC
GCTTTCAACGCTCTCATCCACAGCCACAGGCCGGAGCTGT
TCAGCTGGAGTGTAGTGGAGCAACAGGATAATGCCATTGA
GAGACTGGATCATGCCTTCGGTGTTGCGGAGAAGAGTTTA
GGAATCGACCGGCTGCTGGACCCCGAGGATGTTGCTACAG
TCCATCCAGATAAGAAATCCATCATCATGTACGTCACCTC
CCTCTTCAAAGTGCTGCCCCATGGCGTGAGTTTGGAGGCC
ATCCAAGAGGTGGAGACCCTCCCTCGAGCCGCAGTGACCA
AGGAGGAGCACGTCCTCTATCAAACCCAACAGCGGTACTC
TCAGCAGATCACAGTCAGCGTGGCCCAGAGTCGCGTTCGC
AGCCCGTCGCCCTCCTATAAGCCGAGATTTAAAAGCTATG
CCTTCACTCAAGCCGCCTACGTCAAGACACCTGAACAGCA
GAGGAAGTTCCTCATCGCACAGTCTCCAGACAAGGCCGAT
GAACTGCGACCGTCCCCCAGTCCCCTGCCGCAGGGGCTAA
ATGAGCTGGAAAGCTACCAGAGTGCCCTGGAGGAGGTCCT
GACCTGGCTGCTCTCTGCGGAGGACGGCCTGCAAGCACAG
CCACCCATCTCTTCTTTTGTAGAAGAAGTCAAAGAGCAGT
TTCACACTCATGAGGGCTACATGGTGGAGCTGACGTCTCA
CCAGGGCAGTGTGGGCCGGGTCCTGAAAGCGGGAAGTGTG
TTGTTGTCTGGAGGGCAGCTGACTGATGATGAAGAGAGGG
AGGTGCGGGAACAGATGAATCTGCTCAACTCGCGCTGGGA
ACATCTGCGTGTGGCCAGTATGGAGCGACAGAGCAGGCTT
CATGAAGTTTTGATGGACCTTCAGCACCAGCAGCTGAAGC
AGCTCTCTGATTGGCTGGACACGACGGAGACTCGGATTAA
AAGGATGGGAGCGCAGGCTTTGGGGCCTGAACTTGATGAC
ATAAAGCGGCAAATCGAAGAGCAGAAACTCTTACAGGAAG
ATCTGGAGCTGGAACAAGTGCGAGTGAATTCGCTGACTCA
TATGGTGGTGGTTGTAGATGAGAATAGTGGGGATGGCGCC
ACCGCAGCCTTGGAGGAAAAGCTGCAGAACCTTGGGGAAC
GATGGGCAGCGATCTGTAAATGGACTGAAGAGCGTTGGAT
CCTCCTTCAAAAGATCCTGCTGTGCTGGCAGCATTTCTCT
GAGGAGCAGCTGCTGTTTGATTCTTGGCTGACTCAAAAGG
AGGAGTTGGTCCAGTCCATCCAAAGCAGTGGCACAAATGA
CCCAAATGAAGTAGCCGCCAACCTGCGGAAGCTGGCGATT
TTAAAAGCAGACCTGGAGCTGAAGAGGCAGACCATGGACA
AGCTTTGCTCGCTCGTCCAGGATCTGCTGACTAACATCAA
GAGCAAAGAGGCCGCTGGGAAGCTGGAAGCAAAGCTGGAG
AGGTTTGCTCAGCGCTGGGACAAATTGGTGCAGGCGCTTC
AGCTCACCAGCACCAAGATTTCAACTATTGTCACCACATC
CCAGTCGGAGATCACGCACACAACCATGGCAACTGTCACC
AAGGTGACCACGAACCAGAAGAAGATGGTGAAGCATACTA
AGGAGGGCATGTCCACCCCTCCACCTCAGAAAAAGAGACA
GATTGTTGTGGATTCAGAACTGCGGAAAAGATTTGATGTG
GACTTCACTGAAATTCACAGTTTTATGACTCGGTCCGAGG
CTGTTTTGCAAAATCCCGAGTTCTCAATCTCCCGTAAAGA
AGGCAGTGTGGCAGATCTCTATGAAAAAGTGCTGGCAATT
GACAGGGAAAAACCCGAAAAGTTCAGGAAGTTGCAAGAAG
CCACTCGCTCAGCCCAGGCTTTGGTGGATCAACTTACCAG
CGACGGTCAGAACTCAGAGGACATCCAGCAGGCGGCTCAG
CAGTTACGTGCTCGATGGGTGGACTTCTGCGCTCTCCTGG
CCGAGCGGCTGGCGTGGTTGGCCTACCAGACCAAAGTGCT
GGCTTTCTACAATCTCTTTCAGCAGCTGGAGCAGGCTGCG
GCCACGGCGGAGAACTGGCTGAAGGTGCAGTCGCCGCCCG
CATGTGAACCCGAACCTCTGAGGATCCAGCTGGAGCGCTG
CAGGGATGAAATCTCTCGCCTCTCGGCTCTTCAACCTCAA
GTGGCCAAACTGCACGAACAACTCGAGGAGCTGCGGCAGA
AAGAAGAGACGCCGGTTCTGTTTGACGCGGACATTTCTGC
CTTCCAAGAGCACTACCACCAAGTCCTGGAGGACCTGAGG
GCCAGGGAACGACAGCTCGTTTTGGTCCAGTCTAGTCTTC
CTCCAGCACGTTATAAGGATGTGATGGCAGCGCTGTTGGC
CTGGCTACAGCAGTGTGAGAATAAACTAGCCATCCCTTCT
ACAGCAGTGACTGAGTATCCCGTCATGGAGCAGAGACTCA
AAGATATCAAGGCAATCCAAGCATCCCAGAAGGAGCATCA
GGGTGACGTGGATGACCTCAATAAGATGGCTGAGCAGGTT
TTCCAGAAAGCTCCACCTGAGATCTGTCAGAAGTACCGGA
CAGAGCTGGATAACGTGATGGTGCGCTGGAGACGCATATC
GGAGCAGCTGGAGGAGAACATCCAGAAACTGCAGGATCAC
ATGACCAAGCTACAGCAGTTCCAGAATGACACAAAGACTC
TGCAGAAGTGGATGGCAGAGGTGGATGTTTTCCTGAATGA
GGAATGGCCAGCTCTGGGAGACGCAGAGGCTTTGGAGAAA
CAGTTGGAACAGTGCACGGCTCTGGTGAATGACATCCACA
CCGTCCAACCCAGTCTGAACGGCATCAATGAGGTGGGACT
GGCCTTGAAGAGGGAAGCTGAGACGCCGTTTGCCATCAAA
ATACAGAAGATGCTTGATGAGCTCAATGCGCAGTGGGAGC
TCATTTGCAAACAGGCTTATGCAAAGAAATCAGCCCTGAA
AGGAGGGCTGGACATGACGGTGAGTTTGAGGAAGGAGATG
CAGGAGATGCAGGAGTGGATCACTCAGGCCGAGGAAGAGT
ACCTGGAGAGAGACTTCCAGTACAAAACACCTGAGGAGCT
TCATAAAGCAGTGGAGGAGCTGAAGCGGGCTCAAGAGGAA
GTCCATCAAAAGGAAACAAAGGTGAAGCTGCTGACGGATA
AAGTCACCAATTTCATTTCAAAGGCTCCTCCCGCGGCCCA
TGATGCCCTGAAGGCAGAACTGGATGTTTTGACTTCTAAC
TACCAGCGCCTGTGCAGCCGACTCGATGGAAAATGCAAGA
CTTTAGAGGAAGTGTGGGCATGCTGGTGTGAGCTGCTGTC
TTATTTGGAGTTGGAGAATGCCTGGATGGACCTACTTGAA
AAGAAACTTGATGAAACGGAAGGGCTTCAAGGAGGCATAG
AGGAAATTGAAGAAGCTTTGACTTCTTTAGACACCATGAT
TAGAGAGCATCCTGAATACAACCGTAACCAGATCCGTGAA
TTAGCGCAGACCCTGATGGATGGCCGAGTCCTGGATGAGC
TCATCCACAAAAAGGTGGAGGACTACAACACACGCTGGGA
TGAACTGATGCAAAGGGCTTCACAAAGGCGCCAGCAGCTG
GAGAAGAGCTTGCATTGGGCCCAGGAGAACGACAAAACCC
TGCGTCTCATTCAGGACTCTCTGAACACCACTGACCGACA
TCTGACCGCTTACATAGCAGATGGTATAGACGCTGCACAG
ATACCACAGGAAGCACAGAAAATTCAGACTGAGTTGAACG
GCCATGAGGTGACACTGGATGACATGAAGAAAAAGGCTAT
GGAGGTTGACGCCTCAGAGAAAGTGATTGGAGAGATCGAT
GCAACATTAGATAAACTTTTGCAAGTAAAGGGCAAGTTCC
GGCTTTTCCAAAAGCCAGCGAACTTTGACCAGCGGCTGAG
GGAGTGTGAGCGAGTGCTGGAGGAGGTGAAAGTGAAGCTG
GGAGTGCTGAGTATTCGCAGTGTGGAGCAGGAAGTGGTGC
AGTCACAGCTTGAGCAGTGCATGAAATTTTATAAGAACCT
GAGTGAGGTGAAGTCTGAGGTGGAGACGGTGATAAAGACG
GGGAGGCAGATTGTGCAGAAGCAGCAGACGGAGCAACCCA
AGGAGTTAGACGACAGGCTGACGGCCCTCAAACTCGCTTA
CAATGATTTGGGTTCACAGGTAACAGAAGGAAAGCAGGAA
CTGGAGAAGATTTTGAAGTTACTGAGGAAGTTTAGGAAGG
AGGTGAACAGTCTAACCGAATGGCTGGCTACTACTGATGG
GGAACTGACGCGCCGCTCATCGGTGGAGGGTATGCCAAGT
GATTTGGATGCGGAGTTGGCTTGGGCAAAGGCAGCGCAGG
AGGACACTGAGCATCATAAGCCACAGTTGAAACTGGTGAG
GGAGTTGGCAGGGACCCTGAAGGGTTTACTTCATAGCCAA
GAGAACCTGATTGATGACAAGGTCAGTTTGCTGAACTGCA
ACTGGATCGCAGTGACGTCACGGAGCGAACAGTGGCTCAA
ACTCCTGCTGGATTATCAAAATCAAATGAAAACACTTGAG
CAGAACATTTCTCAGATCAACACCTGGATGGATCGCGCAG
AAGAGAAGCTGGATGAGATGGACAGCCAGGGCTGCATTGA
GCACGTTATAAAGGGTTTGCGAATGGAGTTGGAGGAGATG
AAGGGGAAAGTTGAAGCAGTGCAAGTTCTAGCAGAGGATC
TTATAAAGAACACAGGGGAACATTGTAAAGCTCAAGTGAA
ACCAAAGCTTGAACAGCTTAACCAACGTTTTGACATTGTT
GCAAGAAGGATTTTAATGGGACAGGCCTCCTCCCAAGAGT
TAGACGAGTACCACAGACAGGCTAATATATGGCTCCAGGT
GCTGGACGAGGAGATTAAATTAGGTGAAAGTCTAAAAGAG
GAAGATTTCCTGGAGGATGCGACTATAGACGAGGAGGCTC
TAAATGAACTGTTCCTAAAAGGGGAGAATCTCCTCAAGAG
AACTCCCGGTGGAGAGAAACGAGAGGCCGTTCGAGAGAAA
CACAACCTTCTCCATGACAGATATGACACTCTAAAGAATC
TGAGAGCCCTGAGAAAGAAGAAGGCTCTGGCTCTCGCATC
GCAGTGGTATCAGTTCTGCAAGAAAAGCGATGACATGATG
CAGTGGCTGGACAGAATCGAGAAAAGCATACGAGAGCTTC
CAGATCCCCCGGAGGAGCCCAGAGTGAAAGCAGTTGGATA
TGAGATTGACCAGCAGCGGCCCAAGCTGGAGGATTTACGT
GGATTGGGGCGTGTGCTTTCAGAGGGTGGAGCTAGCAGAA
TGGTTGAGCCCCGCCTCCTGCCTATCAATAAACGATGGAC
GGAGCTAGACGTTAACTTCACTCGAGTGCGCCACAAAAGT
AAAACTTTTGTTCTTTTTCCAAGTAAAATAAGCAGAATAA
TTGAGATTTCTTCTCCATCCTTGTATGTTCAGGAGCTGCA
GTTTCTGCTGCAGTGTATCTCTGAGAATGAGGCTCTGCTG
AACTCTCCCGAGCGCTGGTCTACTGCATTCATCAACCTTC
CCCAACAAGAGAAGTGCCTTAAGGAGGTTAAAGTTAACCT
GGATAAACTGGAGGGTCCCGTGGCAGAGGCTGTTGGAAGA
GGTGCATCTCAACCTGAGGAGGGTTTGCTGGTTCAGCTGC
TCAGGACCAACTGGGAAAACCTTAAAATGCTCTACCAGGA
CAGACTCAAACGCCTTGAAAAAGCCAAGAAGTTCAATGAG
GAGCTGAAAATGCTGGACAACTGGCTCACAGATGCTGAGA
GGACGATTATGAAGTATGAACAAGACCCCATAAATAATAG
AGACCACCTCAAGGAGCTTCAGGCGGGTTTGGAGAAACAG
GAAGCAGCAGTGAAGGGACTCAATGCTCTTGGGACTGATC
TGAGTCCACAGTGCAGTAAAGACGACAGGGACCACATTAA
ACAGCAGCTCGCCTCGATCAACTCCCGCTGGGCCAAAGTG
TCCAACCAGCTCACTGAGATCAAGAGACGGTCTGCCGGGG
CAAAAATGCTTCTCGCAGAGTTAAATGAAGACATGGGGGA
GTTTCAATCCTGGCTGGATGATGCGGAGGCTGTGGCTGCA
CTTCCTGTGGAAGCGGGTCGCAAGGAACAGCTCAGTGCAA
CTTTAGAAAAAGTCAAGGCCCGGGTGGTGGAACTGCCGAG
CAGGAAGCAAGCTCTTCATCAGATCAACAGCAAAGGCTCA
TCTCTCCCCGCTGATAAAGTCAAACCATTGGAGAAGCAAC
TAAAGGTTATCAACATGCGCTGGGCGAAGGTGTCCACTGA
TCTTCCTGAGAAGCAGAGACAAATCGAGGATCTCCTCAGG
GATTTGTCTTTGTACCAAGAACAGCTCTCCAAACTCTCAA
TTTGGGCCTCCAATACAAAGACTCAGCTTGAGCAGTCGCC
TACTGCAGTGGACCCAAAGATTGAGGATGACGTAAAAGAA
AAGAAGCCAGCAGTGGAAACCCTTTTGGCAAAAGAGAGAC
CGCCGTGCCAGCCTGAGAAGGGCCAGTATGACGGTCTGAG
TGCAGATTGGACATCCATTCAAGTTCTCCTTAAAGACTGG
AAAGACAAATGCCAGCTCGCAGCTGTAACTTTGACTGGTA
GTGCAGCAGGAGATGCGGCTCTCGACAAATTCAACAAATC
CTGGACAGAGCTTGACGATTGGTTGGCGCTGCTGGATCAC
ATGGTTCAGACCCAGAGAGTAATGGTGGGGGATCTGGACG
AGATCAACGAAATGACGGTCAAACTCAAGTCAGCACTGCA
AGACATGGAGCAAAGATGCCCACAGCTGAACAAACAAATC
ACTGCGGCTCAGAACCTGAAGAACAAAACCAATAACCCTG
AGACACGGGCAACTATTACAGACCGCATTGAGAAGTTACA
GGCACATTGGGAAGATTCTCATGCCAAGCTGACGGCCAGA
GTTCTTACACTGCAGAACATGTATAAGGACTCCAGCGATT
GGTTGGAGGCCAGAAAAAGGGTGGAGCCTCTCATTAAGAA
AGCCAATGAAAAACTCGAGAGCTGGAAGAAAGTTTCGCAC
AGCGTTGAAGATTTAAAAGGCCAAAATGCAGATGTCAAGC
AACTTTCTAAGGATCTACAGCAGTGGCAGACTCAGATGAA
TGTCACTAATGAGCTGGCAAACAAACTACTGACTCTTTAT
GCAGACGACGACACAAGCAAAGTGAAACAAATGACCGAGA
GCATGAATCTGGCTTGGGCCAACATCAAAAAGCGTGCAGG
GGACAAGGAGGCAGATCTGGAAGCTGGACTTCGGCAGTTG
CAGCATTACTACTTGGACCTGGAGAAATTCCTTAATTGGC
TAACGGAGGCAGAAACCACAGCCAATGTCTTACAAGATGC
CACCTTTAAGGAGGGACTTCTGGAAAATCCTGCCACAGTT
CGACATTTACTCGAGCAATGGCAGGATCTCCAGGCAGAGA
TTGATGCTCACCGGGAGACGTACCATTCATTAGATGAAAA
CGGACATCGTATTGTGTCGTCTCTGGAGGGAACGGACAAT
GCTGTGGTGCTACAAAAACGGCTTGATGACATGGGGCAGC
GCTGGCATGAGTTGTGCAACAAAGTTATGAGTATAAGGCC
CTATCTAGATGCCGGCGTTGATCAGTGGAAACACTTGCAC
ATGTCCTTACAAGAGCTGCTCAACTGGCTGCAGCTGAAGA
GGGAAGAGCTGGAGAAGCAGAAGCCAGTAGGGGGCGACGT
GCCGACCGTTCACCAACAACTCCTCACGCACAAGGCTTTC
AGAAGAGAGCTGGGTGCCAAAGAACCTGTAATCAATGGAA
CTCTCGACAATGCGAAAACCTTCCTTGCTGAGATGCCTCG
TGAGGGCCTGAAACAGAGACCTGGACAAAAAGATGTAAGT
CCTGAGGAGCGGGTTCAAAACGTGGGCCGCATATTGCGTA
AAGAAGTGGAGGATGTAACGGTGCGATGGAAGAATCTGGG
TGCAGCTTCTGTGGACTGGCAGCAACAGCTGGAACTGGCC
TTGGAGAGGCTGATGGAGCTCCAGGACGCCCAGGATCAGC
TGGACTACAAGCTACGACAGGCTGAGAGCGTGAAGAATTC
TTGGAAGCCTGTTGGGGAGCTGCTTGTAGACGATTTGCAA
AACCACATAGACAGAGTGAAGGCATTTCAGGAAGAGATAG
CTCCCATTCAGGATAACGTAAATCATGTTAACCAGCTGGC
CTCCACATTTAGACCGTCTGACATTCAGCTTTCTCCAGAC
AACCTGAGCAGAATCGATGACCTCAACATGAGATGGAGGC
TTCTGCAGATCTCCATTGAGGAGCATCTGAGTCAGCTGAC
CACAGCCTTTAAGGACTTGGGACCCTCTCAGAATTTCCTT
CATGCGTCTGTTGAAAGCCCTCTCGAACGCTCTATTTCAC
CCAACAATGTCCCCTACTATATCAATCACCAGACCCAAAC
AACATGTTGGGACCACCCAAAGATGGCAGAACTCTACCAG
TCATTAGCGGATCTCAACAACGTGCGGTTCTCGGCATACA
GGACGGCAATGAAGCTCAGACGAATGCAGAAAGCCCTCTG
TTTGGATCTTCTGAGCATGCCTGCAGCCTGTGAAGCCTTT
GAGCAGCACAATCTCAAACAGAACGAGCAGTTCATGGACA
TCGTGCAGGTGATCAACTGTCTGACCAGCATCTACGACCG
TCTGGAGCAGCAGCACAGCAGCCTGGTCAACGTGCCTCTC
TGTGTGGACATGTGTCTCAACTGGCTGCTCAACGTTTACG
ATACAGGACGAGCTGGGAAGATTCGTACCCTATCCTTCAA
AACAGGAATAATCTCTTTGTGCAAAGCTCACCTTGAAGAT
AAGTACAGATTTTTATTTCGAGAGGTGGCCAGTGCCACAG
GCTTCTGTGACCAGCGGCGCCTCGGCCTCCTCCTGCATGA
TGCCATTCAGATCCCCAGGCAGCTGGGTGAAGTGGCGTCT
TTCGGAGGGAGCAATATTGAGCCCAGTGTGCGCAGCTGCT
TTCAGTTCGCCAATAACAAACCGGAGTTAGAGGCTTCAGT
CTTCCTGGACTGGATGCGTTTAGAACCTCAGTCGATGGTT
TGGCTTCCTGTCCTTCACCGTGTAGCGGCCGCTGAGACAG
CAAAGCACCAGGCTAAATGCAACATTTGTAAGGAATGTCC
TATTATTGGCTTCAGGTACCGAAGTTTAAAGCACTTTAAC
TATGATATCTGCCAAAGCTGCTTCTTTTCTGGCAGAGTGG
CCAAAGGTCACAAGATGCAGTACCCTATGGTTGAATATTG
CACACCGACGACGTCAGGAGAGGATGTGAGAGACTTTGCC
AAGGTGTTAAAGAACAAGTTCAGGACAAAGCGCTATTTTG
CCAAGCACCCTCGCATGGGTTACCTTCCCGTCCAGACCAT
CCTTGAAGGAGACAACATGGAGACTCCTGTTACACTGATC
AACTTCTGGCCTGTTGACCATCCGCCTGCATCTTCCCCTC
AACTCTCCCATGACGACACCCACTCTCGCATCGAGCATTA
CGCTAGCAGGCTAGCTGAAATGGAGAACCGAAATGGCTCG
TATGTGAATGACAATGTATCGCCCAATGAAAGCATGGATG
ATGAGCATCTGCTGATCCAGCACTACTGCCAGAGTCTGAA
TCAAGGCTCTCCTCTCAGCCAGCCGCAGAGCCCCGCTCAG
ATCCTCATCTCAATGGAGACTGAAGAGAAGGGAGAGCTGG
AGAGAGTGCTCAATGATCTGGAGCAGGAAAACAGGAAGCT
GCAAGCGGAGTACGATCGTCTGAAAAAGGCACACGATCAC
AAGGGTCTGTCACCGTTGCCTTCACCTCCACAGATGCTTC
CGGTGTCGCCTCAAAGTCCACGCGACGCAGAACTAATCGC
AGAAGCCAAACTACTGCGGCAACACAAGGGACGATTGGAG
GCAAGAATGCAAATCCTGGAGGATCACAACAAGCAGCTGG
AATCGCAGCTTACACGCCTAAGACAGTTACTCGAGCAGCC
ACAGACTGAGTCCAAGGTGAATGGCACTGCCCTGTCCTCA
CCCTCCACTGCCTCTCCGAGATCTGACACCAGCCTGGCCT
CACTGCGTGTGGCCGCAAGCCAAACCACAGAGACCATGGG
TGATGATGAGCTGTCCAGTCCCACCCAGGATGCAAGCACT
GGATTAGAAGACGTCATCGAGCAGCTCAACAACTCCTTCC
CTCACAGCCAAGGTCCCAATGTGGGAAGTCTTTTCCACAT
GGTTGATAACATTGGACATGCCATGGAGTCGCTGGTTCAT
GTAATAACAGAGGAGCAGGATTTAGACTGA

dmd TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dmd-201 (1)    Ensembl 3488
dmd-202 (1)    Ensembl 2163
dmd-203 11030
dmd-205 (1)    Ensembl 1196
dmd-209 (1)    Ensembl 722
dmd-211 (1)    Ensembl 579
ncRNA dmd-005 (1)    Ensembl 696
dmd-006 (1)    Ensembl 708
dmd-007 (1)    Ensembl 676
dmd-008 (1)    Ensembl 780
dmd-009 (1)    Ensembl 530
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dmd-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000044458 (1),  Ensembl_Trans:ENSDART00000102903 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY162403 (1) 1622 bp
GenBank:DR721565 (1) 724 bp
GenBank:EB929071 (1) 584 bp
GenBank:EB848689 (1) 560 bp
GenBank:CR928981 (1) 539 bp
GenBank:EB937206 (1) 508 bp
GenBank:CO357441 (1) 463 bp
CITATIONS (2)