Transcript

dmd-009

ID
ZDB-TSCRIPT-091110-1237
Name
dmd-009
Previous Names
  • ch211-140b10.9-001
  • ottdart00000044470
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044470 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044470|OTTDARG00000031909|ZDB-GENE-010426-1 dmd|no_translation dmd-009 LG_none BX323090.7,BX004756.8,BX323020.9 Danio rerio protein_coding KNOWN, 530 bp
ACAGGAAGCTGCAAGCGGAGTACGATCGTCTGAAAAAGGC
ACACGATCACAAGGGTCTGTCACCGTTGCCTTCACCTCCA
CAGATGCTTCCGGTGTCGCCTCAAAGTCCACGCGACGCAG
AACTAATCGCAGAAGCCAAACTACTGCGGCAACACAAGGG
ACGATTGGAGGCAAGAATGCAAATCCTGGAGGATCACAAC
AAGCAGCTGGAATCGCAGCTTACACGCCTAAGACAGTTAC
TCGAGCAGGTGATGATGAGCTGTCCAGTCCCACCCAGGAT
GCAAGCACTGGATTAGAAGACGTCATCGAGCAGCTCAACA
ACTCCTTCCCTCACAGCCAAGGTCCCAATGTGGGAAGTCT
TTTCCACATGGTTGATAACATTGGACATGCCATGGAGTCG
CTGGTTCATGTAATAACAGAGGAGCAGGATTTAGACTGAA
GACGTCTTCTCCTCGTTGCATGCTTTTGTAGTGTCAACAA
CTGGACCGGATATGTTTACAATGGGGAATATCAATAAAAA
TCTATTTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations