ZFIN ID: ZDB-TSCRIPT-090929-18703
Transcript Name: spna2-005
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038313 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038313|OTTDARG00000028194|ZDB-GENE-051113-60 spna2|no_translation spna2-005 LG_none CR792457.15,CU466275.6 Danio rerio protein_coding KNOWN, 861 bp
GCCACTCTTGTAGGGTGTAGTTTGGCATGTGGAGTGAGTG
AGATGTTTTTGGGTGGATGTGCCATGCGTTCGTGAGCTCC
TGCTGCTGGTTTCACCGCTATCTGTTGGACAGGTCCTGCA
TGGTGGAAGAATCTGGAACTCTAGAGTCACAGCTAGAAGC
CACTAAGCGTAAGCATCAGGAGATTCGTGCCATGCGCAGT
CAGCTGAAGAAGATTGAGGATCTGGGAGCTGCCATGGAGG
AGGCGCTGATTCTGGACAATAAATACACAGAACACAGCAC
CGTGGGTCTGGCACAACAGTGGGACCAACTCGACCAGCTG
GGCATGAGAATGCAACATAACCTGGAACAACAGATCCAAG
CCAGAAACACTACAGGTGTAACAGAAGAGGCCCTGAAGGA
GTTCAGCATGATGTTCAAGCACTTCGACAAAGAAAAATCT
GGCCGTCTGAATCACCAGGAGTTCAAGTCTTGTCTGCGGT
CTCTGGGTTACGACCTTCCCATGGTGGAAGAAGGAGAACC
AGACCCAGAGTTTGAGTCCATCCTGGATATAGTGGATCCA
AACAGGGATGGAAACGTGTCCTTGCAGGAGTACATGGCTT
TCATGATCAGCCGAGAAACGGAGAACGTCAAGTCAAGCGA
GGAGATCGAGAGCGCTTTCCGTGCTCTGAGCGCAGAAAAC
AAACCCTACGTCACCAAGGAAGAACTCTACCAGAACCTGA
CAAAGGAACAAGCCGACTACTGCATTTCCCATATGAAGCC
CTACCTAGACAGCAAGGGCCGCGAAATCCCATCAGCTTTC
GACTTTGTGGAATTCACCCGCTCGCTCTTCGTCAACTGAT
TACCCGCCCCCTGCCTGCCAG

sptan1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sptan1-201 (1)    Ensembl 7875
sptan1-202 (1)    Ensembl 1766
sptan1-204 (1)    Ensembl 538
ncRNA spna2-003 (1)    Ensembl 729
spna2-005 861
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spna2-005 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038313 (1),  Ensembl_Trans:ENSDART00000140667 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE326630 (1) 853 nt
CITATIONS (2)