ZFIN ID: ZDB-TSCRIPT-090929-18702
Transcript Name: sptan1-204
Previous Name: spna2-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038312 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038312|OTTDARG00000028194|ZDB-GENE-051113-60 spna2|OTTDARP00000030699 spna2-004 LG_none CR792457.15,CU466275.6 Danio rerio protein_coding KNOWN, 538 bp
CTGGAGTCTGAAGGTCTGATGGCAGAAGAGGCTCCTGTGG
TTCAGGCCCAGGATGAAGCAGACTCCAAAGGTGCATCTCC
ATGGAAGTCTGTTCGCTTGGCTGTTCAAACAACGGCCAAC
TTTAATACTATCAAGGAGCTGAACAACCGCTGGAGGTCTC
TGCAGCAGCTGGCTGAAGACCGAAGCAACATGCTGGGCAG
TGCTCACGAAGTTCAGAGGTTCCACAGAGATGCAGATGAG
ACCAAGGAGTGGATCGAAGAGAAGAACCAAGCCCTGAACA
CTGATAACTATGGCCATGACCTCGCCAGCGTGCAGGCTCT
GCAGCGCAAGCATGAAGGATTTGAGAGAGATCTAGCCGCT
TTAGGAGACAAGGTGAATTCTCTTGGTGAGACTGCAGAGC
GTCTGATTCAATCTCATCCTGAGGCTGTGGATGACATCCA
GGAGAAGTGCACCGAGCTAAACACAGCATGGAGCAGCCTG
GTGGGTCGTGCAGACCAGCGCAAAGAAAAACTGGGCAACT
CCCATGACCTGCAGCGCT

sptan1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sptan1-201 (1)    Ensembl 7875
sptan1-202 (1)    Ensembl 1766
sptan1-204 538
ncRNA spna2-003 (1)    Ensembl 729
spna2-005 (1)    Ensembl 861
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sptan1-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038312 (1),  Ensembl_Trans:ENSDART00000140267 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW077262 (1) 538 nt
CITATIONS (2)