ZFIN ID: ZDB-TSCRIPT-090929-18695
Transcript Name: sptan1-201
Previous Name: spna2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038305 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038305|OTTDARG00000028194|ZDB-GENE-051113-60 spna2|OTTDARP00000030694 spna2-001 LG_none CR792457.15,CU466275.6 Danio rerio protein_coding KNOWN, 7875 bp
ATTTGATCGCTACGTTGCTATTTCATTCGTCGAGATCGCC
GCCCTTTACCAACTAGCCTCAGAAAAAAAACAGAGCAAAT
CCTTCAGCAAGAAAATGGATATCAGTGGAGTCAAGGTTTT
AGAGACGGCAGATGACATCCAAGAGCGCCGACAGCAGGTT
CTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGC
GCAGACAGAAACTCGAAGACTCTTACCGGTTCCAGTTCTT
CCGTCGGGATGCAGATGAACTTGAGAAATGGATCCAAGAG
AAGCTACAGATTGCCTCTGATGAGAACTACAAGGACCCCA
GTAACCTGCAGGGAAAGCTCCAGAAACATCAAGCGTTTGA
AGCAGAGGTGCAGGCTAACGCCGAGGCCATCATCAAACTG
GACGAGACCGGCAACCTCATGATATCCGAGGGCCACTTTG
CATCTGAAACCATCCGCACCCGTCTAGAGGAGCTTCACCG
TCTGTGGGACTTGCTGCTGCAAAAGACTAAAGAGAAGGGA
ATCCGTCTCCTGCAGGCCCAAAAACTGGTTCAGTACCTCC
GTGAGTGTGAGGATGCCCTAGACTGGATCAGTGACAAGGA
AGCTATTGTCACCTCAGAGGAGCTTGGGCAGGACCTGGAA
CATGTGGAGGTCTTGCAGAAGAAGTTTGAAGAGTTCCAGA
CCGATCTGGCAGCCCATGAAGAGCGTGTGAATGAGGTGAA
CCAGGCAGCCGGCAAACTAACCCAGGAGAACCACCCAGAA
GCTGAGCTCATCCTGAAAAAGCAGGAGGAGGTGAACTCCG
CCTGGCAGAGGCTGAAGGGCTTGGCTCAGCAGAGGCAGGG
CAAGCTGTTTGGAGCTGCTGAAGTGCAGCGTTTCAACCGG
GATGTGGATGAGACAATCAGCTGGATTAAGGAGAAGGAGC
AGTTGATGGCATCTGATGATTTTGGTCGTGACCTCGCCAG
CGTTCAAGCTTTGCTCCGGAAACACGAAGGGCTGGAAAGA
GATTTGGCAGCTTTGAATGACAAGGTAAACACTCTTGGTG
GCGAGGCGGACCGTCTGCAGCAAACACACCCCCAGAATGC
CACTCAAATCCACCTGAAGAGAGATGAACTCATTACCAAC
TGGGAGCAGATCCAAACCCTGGCGACTGAGCGACATGCTC
GACTTAATGACTCCTACATGCTGCAGCGCTTCACTGCAGA
TTTCCGCGACTTGACGAGCTGGGTGACCGAGATGAAGGCT
TTGATCAATGCAGATGAACTGGCCAACGATGTGGCTGGAG
CGGAGGCCCTGCTTGATCGCCACCAGGAGCACAAGGGTGA
GATCGACGCTCATGAGGACAGTTTCAAATCTACTGATGAG
GCCGGTCAGGCACTGCTTAACACTGGACATTATGCTTCTG
AGGAAGTCAAAGAAAAACTGGGCATCTTGTCTGAGGAGAA
AGTGTCTCTTCTGGAGCTGTGGGAGCTCCGCAGGCAGCAA
TACGAGCAGTGCATGGACCTGCAGCTCTTTTACAGGGACA
CTGAGCAGGTTGACAACTGGATGAGCAAGCAGGAGGCTTT
CCTGCTGAATGAAGATCTGGGCGATTCTCTGGACAGTGTT
GAGGCTCTTCTAAAGAAACACGAAGACTTTGAGAAATCCC
TCAGTGCTCAGGAAGAAAAGATCACTGCGCTGGATGAATT
TGCCACCAAACTGATCCAGAACAATCACTACGCCAAGGAT
GATGTGGCCACCCGCAGAGATGCACTGCTGAGCAGACGCA
ACGCTCTTCATGAGCGGGCTCAGTTTCGCCGCGCTGCCCT
GGAGGACTCCTTCCATCTGCAGCAGTTCTTCCGAGACTCT
GATGAGCTCAAGAGCTGGATTAACGAGAAGATGAAGACCG
CCACTGATGAGGCCTACAAGGATCCATCCAACCTGCAGGG
AAAGGTCCAGAAGCACCAGGCCTTCGAGGCTGAGCTTTCT
GCCAATCAGAGCCGCATTGATGCACTGCAGAAGTCAGGCC
AGGAGCTGGTGGATGGGAAACATTATGCCTCCAGCGAGGT
GTCCACCCGAATGGATGAAGTCAGCTCTCAATGGAAGAAG
CTTCTGGAGGCAACTGAGCTCAAAGGGATTAAGTTGCGTG
AAGCGAACCAGCAGCAGCAGTTCAATCGCAATGTGGAGGA
CATCGAGCTTTGGCTGTATGAGGTGGAGGGACATCTGGCC
TCTGATGACTTTGGCAAAGACCTGACCAGCGTCCAGAATC
TCCAGAAGAAACATGCTCTTCTAGAAGCTGACGTGGCCGC
TCACCAGGACCGTATTGATGGCATTACCATCCAGGCCAGG
CAGTTCCAAGATGCCGGCCATTTTGATGCTGATAACATCC
GGAAAAAACAAGAGGCTCTAGTGGCACGTTATGAGGCCCT
GAAGGAGCCCATGGCTGCCCGCAAACAGAAGCTGTCCGAC
TCTCTGCGCCTTCAGCAACTTTTTAGGGATGTAGAAGATG
AGGAGACCTGGATCAGAGAGAAGGAACCCATTGCTTCCTC
CACCAACAGAGGAAAAGACCTTATTGGGGTCCAAAACCTT
CTGAAGAAACACCAGGCTCTGCAGGCAGAAATCTCTGGCC
ACGAACCCCGAATCAAGGCTGTTACTCAGAAGGGGGAGGC
CATGATTGATGAAGGTCACTTTGCAGGGGAGGATGTGAAG
GCTAAACTACAAGAGCTGCACAACCGCTGGGACGGGCTGA
AAGGAAAAGCAGCCCAGCGTAGACAGGATCTGGAGGACTC
TCTCCAGGCTCAGCAGTACTTTGCTGATGCCAACGAGGCC
GAGTCCTGGATGAGGGAGAAGGAGCCCATTGTAGGAAGCC
CTGACTACGGCAAAGATGAGGACTCTGCTGAGGCTTTGCT
GAAGAAGCATGAGGCTCTGATGTCTGATTTGAGTGCATAT
GGCAGCAGCATCCAGGCCTTGAAAGAAGAAGCTCAGGCCT
GCAGACAACAAGTGGCCCCCACTGATGACGAGACTGGCAA
GGAGCTGGTTCTGGCTCTGTACGACTACCAGGAGAAGAGT
CCACGTGAGGTCACCATGAAGAAGGGAGACATCCTCACTC
TGCTCAACAGCACCAACAAGGACTGGTGGAAAGTGGAAGT
GAACGACAGGCAGGGCTTTGTTCCCGCAGCGTACGTGAAA
AAGTTGGACCCGACTCAATCTTCCTCTCGTGAAAATCTGC
TGGACGAACAGGGCAGCATCGGTTTGCGACAGGATCAGAT
TGAGAACCAGACTGCGGCCACCAAGGAGGTGTGCAGCGTG
TCTATGCGCATGAAGCAGGTGGAGGAACTGTATGGTACAC
TGCTAGAGTTGGGAGAGAAGAGGAAGGACATGCTGGAGAA
GAGCTGCAAGAAGTTCATGCTTTTCCGTGAGGCGAACGAG
CTGCAGCAGTGGATCAATGAGAAAGAGTCTGCGCTTACTA
ACGAGGAGGTGGGATCTGACCTGGAGCAGGTGGAAGTGCT
GCAGAAGAAGTTTGATGACTTCCAGAAGGATCTGAAAGCA
AATGAGTCTCGGCTGAGGGACATAAACAAGGTGGCGTCTG
AGCTGGAGTCTGAAGGTCTGATGGCAGAAGAGGCTCCTGT
GGTTCAGGCCCAGCAAGTAGAGGTGCTGGGCTCAGCTCCT
GGCAAGGATGAAGCAGACTCCAAAGGTGCATCTCCATGGA
AGTCTGTTCGCTTGGCTGTTCAAACAACGGCCAACTTTAA
TACTATCAAGGAGCTGAACAACCGCTGGAGGTCTCTGCAG
CAGCTGGCTGAAGACCGAAGCAACATGCTGGGCAGTGCTC
ACGAAGTTCAGAGGTTCCACAGAGATGCAGATGAGACCAA
GGAGTGGATCGAAGAGAAGAACCAAGCCCTGAACACTGAT
AACTATGGCCATGACCTCGCCAGCGTGCAGGCTCTGCAGC
GCAAGCATGAAGGATTTGAGAGAGATCTAGCCGCTTTAGG
AGACAAGGTGAATTCTCTTGGTGAGACTGCAGAGCGTCTG
ATTCAATCTCATCCTGAGGCTGTGGATGACATCCAGGAGA
AGTGCACCGAGCTAAACACAGCATGGAGCAGCCTGGTGGG
TCGTGCAGACCAGCGCAAAGAAAAACTGGGCAACTCCCAT
GACCTGCAGCGCTTCCTCAGTGACTTCAGAGATCTCATGT
CTTGGATCAATGGAATCAGGGGACTTGTGTCTTCCGATGA
GCTGGCCAAGGATGTTACTGGTGCTGAAGCCCTGTTGGAG
AGACATCAGGAACACCGCACTGAGATCGACGCTCGTGCAG
GAACCTTCCTGGCTTTTGAGCAGTTTGGACAGCAGCTGCT
CGCTCGTGGGCATTACGCAAGCCCTGAGATCAAACAGAAG
CTGGAGGCTCTTGACCGGGAGCGTGCTGACCTGGAGAAGG
CCTGGGTTCAGCGCAGGATGATGCTGGACCAGTGCCTGGA
GCTGCAGTTGTTTAACCGTGACTGTGAGCAGGCTGAGAAC
TGGATGGCTGCCCGCGAAGCCTTCTTAGCCAGCGATGACA
AGGGAGATTCTCTGGACAGTGTGGAGGCGCTCATTAAGAA
ACACGAGGACTTTGATAAGGCTATCAATGTGCAGGAAGAA
AAGATTGCTGCACTGCAGTCTTTTGCTGACCAGCTCATCA
GCGCTGACCACTATGCCAAGCCTGAGATCTTCAAACGACG
CAGTGAGGTCTTGGACAGGTGGCTCCGCCTCAAGGCTCAG
ATGATTGAGAAACGCTCCAAGCTTGGCGAGTCACAGACTC
TACAGCAGTTCAGCAGAGACGTTGACGAGATCGAAGCTTG
GATCAGTGAGAAACTCCAGACCGCCACAGACGAGTCTTAC
AAAGACCCCACCAACATCCAGCTGTCCAAGCTGCTGAGCA
AACACCAGAAACACCAGGCTTTTGAGGCTGAGCTACACGC
TAACGCTGATCGTATCCGCGGAGTGATTGACACGGGCAAT
GCTCTCATCCAGAGAGGTGCCTGTGCTGGAAGTGAAGATG
CTGTTAAGGCTCGTCTGAATGCTCTGGACGAGCAGTGGCA
GTTCCTGGTCAACAAGTCTGCTGAGAAGAGTCAGAAACTG
AAGGAGGCCAACAAACAGCAGAACTTCAACACTGGCATCA
AGGACTTTGACTTCTGGTTGTCTGAGGTTGAGGCTCTTCT
TGCCTCTGAGGATTATGGGAAAGATCTGGCTTCAGTCAAC
AATCTGCTGAAGAAGCACCAGCTGTTGGAGGCTGATATCT
CTGCTCATGAGGATCGTTTGAAGGATCTTAATGGCCAGGC
TGACAGTCTGATGGCCAGCAACGCTTTCGACACATCTCAG
GTCAAAGACAAGCGGGATGCCGTTAACGGACGCTTCGGCA
AAATCAAGAGCATGGCAGCGGGACGGCGAGCCAAGCTGAA
CGAATCGCATCGTCTGCACCAGTTCTTCAGGGATCTGGAC
GATGAGGAGTCCTGGATTAAGGAAAAGAAGTTGTTGGTGA
GCTCGGAGGACTACGGACGTGATTTGACAGGGGTGCAGAA
TCTGAGGAAGAAGCACAAGAGGCTGGAGGCTGAGCTGGGA
GCACACGAGCCGGCCATTCAGTCTGTGTTGGAGACTGGGA
AGAAGCTGTCTGACGACAACACCATTGGACAGGAGGAGAT
CCAGCAGAGACTGGCCCAGTTTGTGGAGCACTGGAGGGAG
CTGAAGGATCTGGCTGCTGCACGTGGGCAGAGGCTTGAAG
AGTCGCTGGAATACCAGCAGTTTGTGGCGAACGTGGAAGA
AGAGGAAGCCTGGATCAACGAGAAACTGAACCTGGTCGGA
AGTGAAGATTACGGTGATACTCTGGCAGCTGTGCAGGGCT
TGCTGAAGAAACATGAAGCATTTGAAACTGATTTTACTGT
GCACAGGGACCGTGTGAATGATGTGTGTTCCAATGGAGAT
GAACTCGTTAAAAAGGAGAACCACAATGTGGAGAACATCA
TGGCTAAAATGAAGGCGTTGCGTGGAAAAGTGTTGGAGCT
GGAGAGAGCAGCGGCACAGAGGAAAGCCAAGCTGGATGAA
AACTCTGCCTTCCTGCAGTTCAACTGGAAGGCTGATGTGG
TGGAGTCCTGGATTGGTGAGAAGGAAAACAGCCTGAAGAC
TGATGACTATGGTCGCGATCTCTCCTCTGTGCAGACGCTG
CTCACCAAACAGGAAACCTTTGATGCAGGACTTCAGGCCT
TCCAGCAGGAGGGCATCACCAACATCACAGCTCTAAAAGA
CCAGCTGCTGGCAGCCAAACATGTGCAGTCTAAGGCCATC
GAGGCTCGTCACGCCACCCTGATGAAGCGCTGGAACCAAC
TACTATCCAACTCAGCAGCCCGCAAGAAGAAGCTTCTGGA
AGCACAGGACCACTTCAGAAAGGTGGAGGATCTTTTCCTC
ACGTTTGCCAAGAAAGCCTCAGCCTTCAACAGCTGGTTTG
AGAACGCAGAGGAAGATCTGACCGATCCTGTGAGGTGCAA
CTCTCTGGAGGAGATTAGGGCACTGCGGGATGCCCATGAT
GCCTTCCGCTCGTCCCTGAGCTCCGCAGAGGCCGACTTCA
GCCAGCTGGCAGAACTCGATCGGCAGATTAAGAGCTACAA
CGTGGTGTCCAACCCATACACCTGGTTCACCATGGAGGCT
CTGGAGGAGACCTGGAGTAACCTTCAGAAGATCATCAAGG
AGCGAGAACTGGAGCTGCAGAAGGAGCAGCGCCGACAGGA
AGAGAATGATAAACTCAGACAGGAGTTTGCTCAGCATGCT
AATGCTTTCCACCAATGGCTGCAGGAGACCAGGACATACC
TTCTGGATGGGTCCTGCATGGTGGAAGAATCTGGAACTCT
AGAGTCACAGCTAGAAGCCACTAAGCGTAAGCATCAGGAG
ATTCGTGCCATGCGCAGTCAGCTGAAGAAGATTGAGGATC
TGGGAGCTGCCATGGAGGAGGCGCTGATTCTGGACAATAA
ATACACAGAACACAGCACCGTGGGTCTGGCACAACAGTGG
GACCAACTCGACCAGCTGGGCATGAGAATGCAACATAACC
TGGAACAACAGATCCAAGCCAGAAACACTACAGGTGTAAC
AGAAGAGGCCCTGAAGGAGTTCAGCATGATGTTCAAGCAC
TTCGACAAAGAAAAATCTGGCCGTCTGAATCACCAGGAGT
TCAAGTCTTGTCTGCGGTCTCTGGGTTACGACCTTCCCAT
GGTGGAAGAAGGAGAACCAGACCCAGAGTTTGAGTCCATC
CTGGATATAGTGGATCCAAACAGGGATGGAAACGTGTCCT
TGCAGGAGTACATGGCTTTCATGATCAGCCGAGAAACGGA
GAACGTCAAGTCAAGCGAGGAGATCGAGAGCGCTTTCCGT
GCTCTGAGCGCAGAAAACAAACCCTACGTCACCAAGGAAG
AACTCTACCAGAACCTGACAAAGGAACAAGCCGACTACTG
CATTTCCCATATGAAGCCCTACCTAGACAGCAAGGGCCGC
GAAATCCCATCAGCTTTCGACTTTGTGGAATTCACCCGCT
CGCTCTTCGTCAACTGATTACCCGCCCCCTGCCTGCCAGT
GACCAATCGGGACGCGTTTCCCCACCCCTCACAAGAACAC
ACAGCCAAACTGCATGGATCTGAATTGAGAATTCTCTATA
GCACCCAGTATAGCAATATCTGTATCTTGCTATCACTCTT
AACCCCTGCGTATTTATCTGACACTTCCTCATGCTTCACT
GACAATAGTGTAGTGGATCTGTCTGCATTTTATTGTGGTT
GTTTTAGCTGTTAAGTGCTTTGCTTTGTTTAACAATCCTA
TAGAGAGGATATGCTGTAACATCGCTCACGAGACTGCAGT
GTGCTTCAATAAACGCTACTGGTTATAACTGGAAA

sptan1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sptan1-201 7875
sptan1-202 (1)    Ensembl 1766
sptan1-204 (1)    Ensembl 538
ncRNA spna2-003 (1)    Ensembl 729
spna2-005 (1)    Ensembl 861
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sptan1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038305 (1),  Ensembl_Trans:ENSDART00000102251 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EF375552 (1) 7879 nt
GenBank:BC093297 (1) 1403 nt
GenBank:BC108293 (1) 1321 nt
CITATIONS (2)