Transcript

sptan1-202

ID
ZDB-TSCRIPT-090929-18700
Name
sptan1-202
Previous Names
  • spna2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000038310 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038310|OTTDARG00000028194|ZDB-GENE-051113-60 spna2|OTTDARP00000030698 spna2-002 LG_none CR792457.15,CU466275.6 Danio rerio protein_coding KNOWN, 1766 bp
GAAACCTTTGATGCAGGACTTCAGGCCTTCCAGCAGGAGG
GCATCACCAACATCACAGCTCTAAAAGACCAGCTGCTGGC
AGCCAAACATGTGCAGTCTAAGGCCATCGAGGCTCGTCAC
GCCACCCTGATGAAGCGCTGGAACCAACTACTATCCAACT
CAGCAGCCCGCAAGAAGAAGCTTCTGGAAGCACAGGACCA
CTTCAGAAAGGTGGAGGATCTTTTCCTCACGTTTGCCAAG
AAAGCCTCAGCCTTCAACAGCTGGTTTGAGAACGCAGAGG
AAGATCTGACCGATCCTGTGAGGTGCAACTCTCTGGAGGA
GATTAGGGCACTGCGGGATGCCCATGATGCCTTCCGCTCG
TCCCTGAGCTCCGCAGAGGCCGACTTCAGCCAGCTGGCAG
AACTCGATCGGCAGATTAAGAGCTACAACGTGGTGTCCAA
CCCATACACCTGGTTCACCATGGAGGCTCTGGAGGAGACC
TGGAGTAACCTTCAGAAGATCATCAAGGAGCGAGAACTGG
AGCTGCAGAAGGAGCAGCGCCGACAGGAAGAGAATGATAA
ACTCAGACAGGAGTTTGCTCAGCATGCTAATGCTTTCCAC
CAATGGCTGCAGGAGACCAGGACATACCTTCTGGATGGCA
TAGCCTATCGGAGGGTAATCCGTGTCTATCAGTATGAAGT
CGATGATGATCTTTCTGGAAGGTCCTGCATGGTGGAAGAA
TCTGGAACTCTAGAGTCACAGCTAGAAGCCACTAAGCGTA
AGCATCAGGAGATTCGTGCCATGCGCAGTCAGCTGAAGAA
GATTGAGGATCTGGGAGCTGCCATGGAGGAGGCGCTGATT
CTGGACAATAAATACACAGAACACAGCACCGTGGGTCTGG
CACAACAGTGGGACCAACTCGACCAGCTGGGCATGAGAAT
GCAACATAACCTGGAACAACAGATCCAAGCCAGAAACACT
ACAGGTGTAACAGAAGAGGCCCTGAAGGAGTTCAGCATGA
TGTTCAAGCACTTCGACAAAGAAAAATCTGGCCGTCTGAA
TCACCAGGAGTTCAAGTCTTGTCTGCGGTCTCTGGGTTAC
GACCTTCCCATGGTGGAAGAAGGAGAACCAGACCCAGAGT
TTGAGTCCATCCTGGATATAGTGGATCCAAACAGGGATGG
AAACGTGTCCTTGCAGGAGTACATGGCTTTCATGATCAGC
CGAGAAACGGAGAACGTCAAGTCAAGCGAGGAGATCGAGA
GCGCTTTCCGTGCTCTGAGCGCAGAAAACAAACCCTACGT
CACCAAGGAAGAACTCTACCAGAACCTGACAAAGGAACAA
GCCGACTACTGCATTTCCCATATGAAGCCCTACCTAGACA
GCAAGGGCCGCGAAATCCCATCAGCTTTCGACTTTGTGGA
ATTCACCCGCTCGCTCTTCGTCAACTGATTACCCGCCCCC
TGCCTGCCAGTGACCAATCGGGACGCGTTTCCCCACCCCT
CACAAGAACACACAGCCAAACTGCATGGATCTGAATTGAG
AATTCTCTATAGCACCCAGTATAGCAATATCTGTATCTTG
CTATCACTCTTAACCCCTGCGTATTTATCTGACACTTCCT
CATGCTTCACTGACAATAGTGTAGTGGATCTGTCTGCATT
TTATTGTGGTTGTTTTAGCTGTTAAGTGCTTTGCTTTGTT
TAACAATCCTATAGAGAGGATATGCTGTAACATCGCTCAC
GAGACTGCAGTGTGCTTCAATAAACGCTACTGGTTATAAC
TGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations