Transcript

spna2-003

ID
ZDB-TSCRIPT-090929-18701
Name
spna2-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000038311 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038311|OTTDARG00000028194|ZDB-GENE-051113-60 spna2|no_translation spna2-003 LG_none CR792457.15,CU466275.6 Danio rerio protein_coding KNOWN, 729 bp
ACCGTATTGATGGCATTACCATCCAGGCCAGGCAGTTCCA
AGATGCCGGCCATTTTGATGCTGATAACATCCGGAAAAAA
CAAGAGGCTCTAGTGGCACGTTATGAGGCCCTGAAGGAGC
CCATGGCTGCCCGCAAACAGAAGCTGTCCGACTCTCTGCG
CCTTCAGCAACTTTTTAGGGATGTAGAAGATGAGGAGACC
TGGATCAGAGAGAAGGAACCCATTGCTTCCTCCACCAACA
GAGGAAAAGACCTTATTGGGGTCCAAAACCTTCTGAAGAA
ACACCAGGCTCTGCAGGCAGAAATCTCTGGCCACGAACCC
CGAATCAAGGCTGTTACTCAGAAGGGGGAGGCCATGATTG
ATGAAGGTCACTTTGCAGGGGAGGATGTGAAGGCTAAACT
ACAAGAGCTGCACAACCGCTGGGACGGGCTGAAAGGAAAA
GCAGCCCAGCGTAGACAGGATCTGGAGGACTCTCTCCAGG
CTCAGCAGTACTTTGCTGATGCCAACGAGGCCGAGTCCTG
GATGAGGGAGAAGGAGCCCATTGTAGGAAGCCCTGACTAC
GGCAAAGATGAGGACTCTGCTGAGGTAAACAACAAGACGA
CTGGATGCTATCCAGAGTGGGCTACTTTTGGGTTTATAGG
AGTAAAATTAGTTTCAGATTTGAGCAAAACATGCAACGTT
TTATGAAAGTAGTCCACAGGGTTCATACGGTCGTGGAAAA
CCTGGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations