header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-180208-3
Morpholino Name: MO2-pnrc2
Target: pnrc2 (1)
Sequence:
5' - ACTGGATGTCACCTAGCAGAAGACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice blocking MO, target the junction intron2-exon3
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pnrc2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pnrc2
Expressed Gene Anatomy Figures
her1 Fig. 1 with imageFig. 6 with image from Gallagher et al., 2017
PHENOTYPE
Phenotype resulting from MO2-pnrc2
Phenotype of all Fish created by or utilizing MO2-pnrc2
OTHER MO2-pnrc2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)