header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150126-6
Morpholino Name: MO3-ccn2a
Target: ccn2a (1)
Previous Name: MO3-ctgfa

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGTCATTCCAGAAAACATGATGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-ccn2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-ccn2a No data available
PHENOTYPE
Phenotype resulting from MO3-ccn2a
Phenotype of all Fish created by or utilizing MO3-ccn2a
Phenotype Fish Conditions Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg + MO3-ctgfa standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal ha01Tg + MO3-ctgfa standard conditions Fig. 3 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg + MO3-ctgfa standard conditions Fig. 3 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg + MO3-ctgfa standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO3-ctgfa standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ctgfa standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ctgfa standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ctgfa standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ctgfa standard conditions Fig. 2 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ctgfa standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ctgfa standard conditions Fig. 2 with image from Fukui et al., 2014
OTHER MO3-ccn2a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)