header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140611-1
Morpholino Name: MO6-sox2
Target: sox2 (1)
Previous Name: sox2-MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTTGAAAGTCTACCCCACCAGCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-sox2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-sox2
Expressed Gene Anatomy Figures
gfi1ab Fig. 7 with image from Pavlou et al., 2014
kctd12.1 Fig. 7 with image from Pavlou et al., 2014
noto Fig. 3 with image from Pavlou et al., 2014
PHENOTYPE
Phenotype resulting from MO6-sox2
Phenotype of all Fish created by or utilizing MO6-sox2
Genome Resources:
CITATIONS (1)