Morpholino

MO3-nkx2.5

ID
ZDB-MRPHLNO-090826-12
Name
MO3-nkx2.5
Previous Names
  • anti-nkx2.5 splice MO (1)
Target
Sequence
5' - TGTCAAGGCTCACCTTTTTTCTCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nkx2.5
Phenotype
Phenotype resulting from MO3-nkx2.5
Phenotype of all Fish created by or utilizing MO3-nkx2.5
Phenotype Fish Conditions Figures
pharyngeal vasculature blood vessel endothelial cell differentiation decreased occurrence, abnormal WT + MO3-nkx2.5 standard conditions Fig. 4 from Paffett-Lugassy et al., 2013
cardiac ventricle decreased size, abnormal WT + MO3-nkx2.5 standard conditions text only from Targoff et al., 2008
atrium shape, abnormal WT + MO3-nkx2.5 standard conditions text only from Targoff et al., 2008
atrium dilated, abnormal WT + MO3-nkx2.5 standard conditions Fig. 4 from Yin et al., 2020
anterior lateral plate mesoderm atf3 expression decreased amount, abnormal WT + MO3-nkx2.5 standard conditions Fig. 4 from Yin et al., 2020
pharyngeal vasculature angioblast cell differentiation decreased process quality, abnormal WT + MO3-nkx2.5 standard conditions Fig. 5 from Paffett-Lugassy et al., 2013
pharyngeal vasculature has fewer parts of type blood vessel endothelial cell, abnormal fb7Tg; y7Tg + MO3-nkx2.5 standard conditions Fig. 4 from Paffett-Lugassy et al., 2013
pharyngeal vasculature vasculogenesis decreased process quality, abnormal la116Tg; sd2Tg + MO3-nkx2.5 standard conditions Fig. 3 from Paffett-Lugassy et al., 2013
pharyngeal vasculature pharyngeal arch artery morphogenesis decreased process quality, abnormal la116Tg; sd2Tg + MO3-nkx2.5 standard conditions Fig. 3 from Paffett-Lugassy et al., 2013
pharyngeal vasculature malformed, abnormal la116Tg; sd2Tg + MO3-nkx2.5 standard conditions Fig. 3 from Paffett-Lugassy et al., 2013
aortic arch angioblastic mesenchymal cell tie1 expression absent, abnormal AB/TU + MO1-stat4 + MO3-nkx2.5 standard conditions Fig. 6 with image from Meng et al., 2017
ventricular system swollen, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions text only from Targoff et al., 2008
cardiac ventricle decreased size, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. 2 with image from Targoff et al., 2008
cardiac ventricle decreased length, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. S2 with image from Targoff et al., 2008
atrium dilated, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. 2 with image from Targoff et al., 2008
atrium spherical, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. 2 with image from Targoff et al., 2008
cardiac ventricle increased width, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. S2 with image from Targoff et al., 2008
cardiac ventricle circular, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. 2 with image from Targoff et al., 2008
mandibular arch skeleton decreased size, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions text only from Targoff et al., 2008
pericardium edematous, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions text only from Targoff et al., 2008
heart contraction decreased intensity, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions text only from Targoff et al., 2008
embryonic heart tube development disrupted, abnormal WT + MO2-nkx2.7 + MO3-nkx2.5 standard conditions Fig. S2 with image from Targoff et al., 2008
Citations