Morpholino

MO1-ccbe1

ID
ZDB-MRPHLNO-090507-1
Name
MO1-ccbe1
Previous Names
  • ccbe1 ATG MO (1)
Target
Sequence
5' - CGGGTAGATCATTTCAGACACTCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccbe1
No data available
Phenotype
Phenotype resulting from MO1-ccbe1
Phenotype Fish Figures
dorsal longitudinal lymphatic vessel aplastic, abnormal y1Tg + MO1-ccbe1 Fig. 1 from Hogan et al., 2009
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
intersegmental lymph vessel aplastic, abnormal y1Tg + MO1-ccbe1 Fig. 1 from Hogan et al., 2009
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO1-ccbe1 Fig. S5 with image from Astin et al., 2014
lymphangioblast cord absent, abnormal y1Tg + MO1-ccbe1 Fig. 6 with image from Le Guen et al., 2014
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 Fig. 3 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu4453Tg + MO1-ccbe1 Fig. 1Fig. 2 from Hogan et al., 2009
MAPK cascade disrupted, abnormal y1Tg + MO1-ccbe1 Fig. 4 with image from Le Guen et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO1-ccbe1 Fig. S7 from Bower et al., 2017
posterior cardinal vein ab9-mapk labeling decreased distribution, abnormal y1Tg + MO1-ccbe1 Fig. 4 with image from Kärpanen et al., 2017
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO1-ccbe1 Fig. S2 with image from Astin et al., 2014
thoracic duct aplastic, abnormal y1Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
Fig. 2 from Alders et al., 2009
Fig. 1 from Hogan et al., 2009
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 Fig. 3 with image from Weijts et al., 2013
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 Fig. 1 with image from Astin et al., 2014
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-ccbe1 Fig. 2 from Hogan et al., 2009
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO1-ccbe1 Fig. 6 with image from Le Guen et al., 2014
Phenotype of all Fish created by or utilizing MO1-ccbe1
Phenotype Fish Conditions Figures
thoracic duct aplastic, abnormal WT + MO1-ccbe1 standard conditions Fig. 2 from Alders et al., 2009
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4453Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. S2 with image from Astin et al., 2014
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
thoracic duct aplastic, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
thoracic duct aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
dorsal longitudinal lymphatic vessel aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
MAPK cascade disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 4 with image from Le Guen et al., 2014
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 6 with image from Le Guen et al., 2014
posterior cardinal vein ab9-mapk labeling decreased distribution, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 4 with image from Kärpanen et al., 2017
intersegmental lymph vessel aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
lymphangioblast cord absent, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 6 with image from Le Guen et al., 2014
angiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 3 with image from Weijts et al., 2013
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO1-ccbe1 standard conditions Fig. S5 with image from Astin et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO1-ccbe1 standard conditions Fig. S7 from Bower et al., 2017
lymphangiogenesis disrupted, abnormal s916Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 2 from Crawford et al., 2016
lymph vessel EGFP expression absent, abnormal s916Tg; y1Tg + MO1-ccbe1 control Fig. 2 from Crawford et al., 2016
thoracic duct absent, abnormal s916Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 2 from Crawford et al., 2016
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel separated from dorsal longitudinal anastomotic vessel, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
Citations