header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090507-1
Morpholino Name: MO1-ccbe1
Target: ccbe1 (1)
Previous Name: ccbe1 ATG MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGGGTAGATCATTTCAGACACTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ccbe1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ccbe1 No data available
PHENOTYPE
Phenotype resulting from MO1-ccbe1
Phenotype Figures
dorsal longitudinal lymphatic vessel aplastic, abnormal Fig. 1 from Hogan et al., 2009
facial lymphatic vessel lateral region decreased length, abnormal Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal Fig. 1 with image from Astin et al., 2014
intersegmental lymph vessel aplastic, abnormal Fig. 1 from Hogan et al., 2009
intestine lymphangiogenesis decreased process quality, abnormal Fig. S5 with image from Astin et al., 2014
lymphangioblast cord absent, abnormal Fig. 6 with image from Le Guen et al., 2014
lymphangioblast cord lymphangioblast decreased amount, abnormal Fig. 3 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal Fig. 1Fig. 2 from Hogan et al., 2009
MAPK cascade disrupted, abnormal Fig. 4 with image from Le Guen et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal Fig. S7 from Bower et al., 2017
posterior cardinal vein ab9-mapk labeling decreased distribution, abnormal Fig. 4 with image from Kärpanen et al., 2017
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal Fig. S2 with image from Astin et al., 2014
thoracic duct aplastic, abnormal Fig. 1 with image from Astin et al., 2014
Fig. 2 from Alders et al., 2009
Fig. 1 from Hogan et al., 2009
thoracic duct morphology, abnormal Fig. 3 with image from Weijts et al., 2013
thoracic duct lymphangiogenesis decreased process quality, abnormal Fig. 1 with image from Astin et al., 2014
trunk lymph vasculature aplastic, abnormal Fig. 2 from Hogan et al., 2009
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal Fig. 6 with image from Le Guen et al., 2014

Phenotype of all Fish created by or utilizing MO1-ccbe1
Phenotype Fish Conditions Figures
thoracic duct aplastic, abnormal WT + MO1-ccbe1 standard conditions Fig. 2 from Alders et al., 2009
trunk lymph vasculature aplastic, abnormal hu4453Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4453Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. S2 with image from Astin et al., 2014
thoracic duct lymphangiogenesis decreased process quality, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
facial lymphatic vessel lateral region decreased length, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
thoracic duct aplastic, abnormal nz150Tg + MO1-ccbe1 standard conditions Fig. 1 with image from Astin et al., 2014
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
thoracic duct aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
dorsal longitudinal lymphatic vessel aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
MAPK cascade disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 4 with image from Le Guen et al., 2014
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 6 with image from Le Guen et al., 2014
posterior cardinal vein ab9-mapk labeling decreased distribution, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 4 with image from Kärpanen et al., 2017
intersegmental lymph vessel aplastic, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 1 from Hogan et al., 2009
lymphangioblast cord absent, abnormal y1Tg + MO1-ccbe1 standard conditions Fig. 6 with image from Le Guen et al., 2014
angiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal hu4624Tg; s916Tg + MO1-ccbe1 standard conditions Fig. 2 from Hogan et al., 2009
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 3 with image from Weijts et al., 2013
intestine lymphangiogenesis decreased process quality, abnormal nz101Tg; s843Tg + MO1-ccbe1 standard conditions Fig. S5 with image from Astin et al., 2014
midbrain lymph vessel lacks all parts of type endothelial cell, abnormal nz101Tg; s843Tg + MO1-ccbe1 standard conditions Fig. S7 from Bower et al., 2017
lymphangiogenesis disrupted, abnormal s916Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 2 from Crawford et al., 2016
lymph vessel EGFP expression absent, abnormal s916Tg; y1Tg + MO1-ccbe1 control Fig. 2 from Crawford et al., 2016
thoracic duct absent, abnormal s916Tg; y1Tg + MO1-ccbe1 standard conditions Fig. 2 from Crawford et al., 2016
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
thoracic duct morphology, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
dorsal longitudinal anastomotic vessel separated from dorsal longitudinal anastomotic vessel, abnormal hu5333Tg; y1Tg + MO1-ccbe1 + MO1-e2f7 + MO1-e2f8 standard conditions Fig. 3 with image from Weijts et al., 2013
Genome Resources:
CITATIONS (14)