Morpholino

MO1-zeb2a

ID

ZDB-MRPHLNO-080717-3

Name

MO1-zeb2a

Previous Names

Target

Sequence

5' - GTCCGCATGGGCTCCGCTCCTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-zeb2a

Expressed Gene	Anatomy	Figures
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 3 from Delalande et al., 2008
myod1	segmental plate somite	Fig. 3 from Delalande et al., 2008
pax2a	midbrain hindbrain boundary neural rod	Fig. 3 from Delalande et al., 2008

Phenotype

Phenotype resulting from MO1-zeb2a

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO1-zeb2a	text only from Delalande et al., 2008
central nervous system development disrupted, abnormal	WT + MO1-zeb2a	text only from Delalande et al., 2008
dorsal convergence disrupted, abnormal	WT + MO1-zeb2a	Fig. 3 from Delalande et al., 2008
heart morphology, abnormal	WT + MO1-zeb2a	text only from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-zeb2a	text only from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal	WT + MO1-zeb2a	text only from Delalande et al., 2008

Phenotype of all Fish created by or utilizing MO1-zeb2a

Phenotype	Fish	Conditions	Figures
whole organism anterior-posterior axis curved ventral, abnormal	WT + MO1-zeb2a	standard conditions	text only from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-zeb2a	standard conditions	text only from Delalande et al., 2008
heart morphology, abnormal	WT + MO1-zeb2a	standard conditions	text only from Delalande et al., 2008
central nervous system development disrupted, abnormal	WT + MO1-zeb2a	standard conditions	text only from Delalande et al., 2008
dorsal convergence disrupted, abnormal	WT + MO1-zeb2a	standard conditions	Fig. 3 from Delalande et al., 2008
brain morphology, abnormal	WT + MO1-zeb2a	standard conditions	text only from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
somite morphology, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
dorsal convergence disrupted, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008

Citations