header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070627-2
Morpholino Name: MO3-spry4
Target: spry4 (1)
Sequence:
5' - GGAACCCTTGACTCCATCTGTAGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-spry4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-spry4
Expressed Gene Anatomy Figures
egr2b Fig. 2 with imageFig. 3 with image from Labalette et al., 2011
her5 Fig. 2 with image from Labalette et al., 2011
hoxb1a Fig. 2 with image from Labalette et al., 2011
tbxta Fig. 3 with image from Labalette et al., 2011
PHENOTYPE
Phenotype resulting from MO3-spry4
Phenotype of all Fish created by or utilizing MO3-spry4
Phenotype Fish Conditions Figures
neural plate decreased length, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 4 decreased area, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere formation decreased process quality, abnormal WT + MO3-spry4 standard conditions Fig. 2 with imageFig. 3 with image from Labalette et al., 2011
neural plate increased width, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 3 increased area, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 5 increased area, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 5 physical object quality, abnormal WT + MO3-spry4 standard conditions Fig. 3 with image from Labalette et al., 2011
rhombomere 3 fused with rhombomere 5, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
presumptive rhombomere 3 GFP expression increased amount, abnormal zf1077Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression increased amount, abnormal zf1077Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1078Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1078Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
OTHER MO3-spry4 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)