Morpholino

MO3-spry4

ID
ZDB-MRPHLNO-070627-2
Name
MO3-spry4
Previous Names
None
Target
Sequence
5' - GGAACCCTTGACTCCATCTGTAGGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spry4
Expressed Gene Anatomy Figures
egr2b Fig. 2 with image,  Fig. 3 with image from Labalette et al., 2011
her5 Fig. 2 with image from Labalette et al., 2011
hoxb1a Fig. 2 with image from Labalette et al., 2011
tbxta Fig. 3 with image from Labalette et al., 2011
Phenotype
Phenotype resulting from MO3-spry4
Phenotype Fish Figures
neural plate decreased length, abnormal WT + MO3-spry4 Fig. 2 with image from Labalette et al., 2011
neural plate increased width, abnormal WT + MO3-spry4 Fig. 2 with image from Labalette et al., 2011
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1078Tg + MO3-spry4 Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 3 GFP expression increased amount, abnormal zf1077Tg + MO3-spry4 Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1078Tg + MO3-spry4 Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression increased amount, abnormal zf1077Tg + MO3-spry4 Fig. 5 with image from Labalette et al., 2015
rhombomere 3 fused with rhombomere 5, abnormal WT + MO3-spry4 Fig. 2 with image from Labalette et al., 2011
rhombomere 3 increased area, abnormal WT + MO3-spry4 Fig. 2 with image from Labalette et al., 2011
rhombomere 4 decreased area, abnormal WT + MO3-spry4 Fig. 2 with image from Labalette et al., 2011
rhombomere 5 increased area, abnormal WT + MO3-spry4 Fig. 2 with image from Labalette et al., 2011
rhombomere 5 physical object quality, abnormal WT + MO3-spry4 Fig. 3 with image from Labalette et al., 2011
rhombomere formation decreased process quality, abnormal WT + MO3-spry4 Fig. 2 with image,  Fig. 3 with image from Labalette et al., 2011
Phenotype of all Fish created by or utilizing MO3-spry4
Phenotype Fish Conditions Figures
neural plate decreased length, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 4 decreased area, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere formation decreased process quality, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image,  Fig. 3 with image from Labalette et al., 2011
neural plate increased width, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 3 increased area, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 5 increased area, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
rhombomere 5 physical object quality, abnormal WT + MO3-spry4 standard conditions Fig. 3 with image from Labalette et al., 2011
rhombomere 3 fused with rhombomere 5, abnormal WT + MO3-spry4 standard conditions Fig. 2 with image from Labalette et al., 2011
presumptive rhombomere 3 GFP expression increased amount, abnormal zf1077Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression increased amount, abnormal zf1077Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1078Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1078Tg + MO3-spry4 standard conditions Fig. 5 with image from Labalette et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.