header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051107-2
Morpholino Name: MO2-tbx16
Target: tbx16 (1)
Previous Name: spt MO #2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATGTCCTCTAAAAGAAAATGTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tbx16 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tbx16
Expressed Gene Anatomy Figures
dand5 Fig. 1 with image from Gourronc et al., 2007
nphs1 Fig. 8 with image from Huang et al., 2013
nphs2 Fig. 8 with image from Huang et al., 2013
slc20a1a Fig. 8 with image from Huang et al., 2013
spaw Fig. 1 with image from Gourronc et al., 2007
PHENOTYPE
Phenotype resulting from MO2-tbx16
No data available

Phenotype of all Fish created by or utilizing MO2-tbx16
Phenotype Fish Conditions Figures
mesoderm morphology, abnormal WT + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 2 with image from Row et al., 2011
mesodermal cell migration disrupted, abnormal WT + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 3 with image from Row et al., 2011
mesodermal to mesenchymal transition involved in gastrulation disrupted, abnormal WT + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 2 with image from Row et al., 2011
mesoderm decreased amount, abnormal WT + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 3 with image from Araya et al., 2014
mesodermal cell spatial pattern, abnormal WT + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 3 with image from Row et al., 2011
hypoblast bleb increased amount, abnormal WT + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 2 with image from Row et al., 2011
hypoblast bleb increased amount, abnormal w72Tg + MO1-tbx16 + MO2-tbx16(WIK/AB) heat shock Fig. 5 with image from Row et al., 2011
somite development disrupted, abnormal w72Tg + MO1-tbx16 + MO2-tbx16(WIK/AB) heat shock Fig. 4 with image from Row et al., 2011
somite decreased amount, abnormal w72Tg + MO1-tbx16 + MO2-tbx16(WIK/AB) heat shock Fig. 4 with image from Row et al., 2011
somite decreased amount, abnormal w72Tg + MO1-tbx16 + MO2-tbx16(WIK/AB) standard conditions Fig. 4 with image from Row et al., 2011
somite development disrupted, abnormal w72Tg + MO1-tbx16 + MO2-tbx16(WIK/AB) standard conditions Fig. 4 with image from Row et al., 2011
mesoderm absent, abnormal tdgf1tz257/tz257 + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 3 with image from Araya et al., 2014
neural tube morphology, abnormal tdgf1tz257/tz257 + MO1-tbx16 + MO2-tbx16 standard conditions Fig. 3 with image from Araya et al., 2014
OTHER MO2-tbx16 MORPHOLINO PAGESNo links to external sites
CITATIONS (11)