header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050926-1
Morpholino Name: MO1-dhrs9
Target: dhrs9 (1)
Previous Names: MO1-rdh1l, rdh1l GT-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTGTCAGTGACTCACCCTTCTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking morpholino. Sequence verified by author. This morpholino matches accession CAAK01001941 (Ensembl version 4 scaffold Zv4_533), but has a one base mismatch to comparable sequence from Ensembl version 5 scaffold Zv5_1468.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dhrs9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dhrs9
Expressed Gene Anatomy Figures
crestin Fig. 4Fig. 5 from Wang et al., 2013
crip2 Fig. 5 from Wang et al., 2013
dlx2a Fig. 5 from Wang et al., 2013
myh6 Fig. 2 from Wang et al., 2013
myh7 Fig. 2 from Wang et al., 2013
myl7 Fig. 3 from Wang et al., 2013
pitx2 Fig. 3 from Wang et al., 2013
ptgs2a Fig. 3 from Eisinger et al., 2006
snai1b Fig. 4 from Wang et al., 2013
PHENOTYPE
Phenotype resulting from MO1-dhrs9
Phenotype of all Fish created by or utilizing MO1-dhrs9
Phenotype Fish Conditions Figures
neural crest cell decreased amount, abnormal AB + MO1-dhrs9 standard conditions Fig. 4Fig. 5 from Wang et al., 2013
neural crest cell migration process quality, abnormal AB + MO1-dhrs9 standard conditions Fig. 5 from Wang et al., 2013
post-vent region curved ventral, abnormal AB + MO1-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
heart decreased contractility, abnormal AB + MO1-dhrs9 standard conditions Fig. 6 from Wang et al., 2013
heart decreased functionality, abnormal AB + MO1-dhrs9 standard conditions Fig. 6 from Wang et al., 2013
atrium decreased size, abnormal AB + MO1-dhrs9 standard conditions Fig. 2 from Wang et al., 2013
heart looping disrupted, abnormal AB + MO1-dhrs9 standard conditions Fig. 3 from Wang et al., 2013
heart contraction decreased rate, abnormal AB + MO1-dhrs9 standard conditions Fig. 6 from Wang et al., 2013
whole organism decreased size, abnormal AB + MO1-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
heart looping arrested, abnormal AB + MO1-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO1-dhrs9 standard conditions text only from Nadauld et al., 2005
mandibular arch skeleton absent, abnormal WT + MO1-dhrs9 standard conditions text only from Nadauld et al., 2005
pectoral fin development disrupted, abnormal WT + MO1-dhrs9 standard conditions text only from Nadauld et al., 2005
pectoral fin absent, abnormal WT + MO1-dhrs9 standard conditions text only from Nadauld et al., 2005
eye decreased size, abnormal WT + MO1-dhrs9 standard conditions text only from Nadauld et al., 2005
Genome Resources:
CITATIONS (3)