CRISPR

CRISPR1-kif5ba

ID

ZDB-CRISPR-151218-3

Name

CRISPR1-kif5ba

Previous Names

None

Target

kif5ba (1)

Sequence

5' - GGACAGGATAGCGTCGTGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ae11	kif5ba
ae12	kif5ba

Expression

Gene expression in Wild Types + CRISPR1-kif5ba

No data available

Phenotype

Phenotype resulting from CRISPR1-kif5ba

No data available

Phenotype of all Fish created by or utilizing CRISPR1-kif5ba

Phenotype	Fish	Conditions	Figures
whole organism lacks all parts of type notochord, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
whole organism wholly ventralized, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
somite cuboid, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
germ cell development decreased process quality, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
blastomere cleavage furrow nanos3 expression absent, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
head decreased size, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal	kif5ba^ae11/ae11 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
chondrocyte endoplasmic reticulum position, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte mitochondrion position, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
head flattened, abnormal	kif5ba^ae12/ae12	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
testis lacks all parts of type germ line cell, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased distribution, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
whole organism lacks all parts of type primordial germ cell, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region has extra parts of type unfertilized egg cortical granule, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 7 from Campbell et al., 2015
germ cell development decreased process quality, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
whole organism wholly ventralized, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
egg activation decreased process quality, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
somite cuboid, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
unfertilized egg sybu expression increased amount, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg microtubule disorganized, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 7 from Campbell et al., 2015
head decreased size, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
whole organism lacks all parts of type notochord, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased amount, abnormal	kif5ba^ae12/ae12 (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
testis lacks all parts of type germ line cell, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased distribution, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
germ cell development decreased process quality, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
unfertilized egg posterior region wnt8a expression mislocalised, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
whole organism wholly ventralized, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
egg activation decreased process quality, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
somite cuboid, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
blastomere cleavage furrow ddx4 expression absent, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
blastomere cleavage furrow nanos3 expression absent, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 2 from Campbell et al., 2015
head decreased size, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
dorsal/ventral pattern formation decreased process quality, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
whole organism lacks all parts of type notochord, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 5 from Campbell et al., 2015
unfertilized egg posterior region sybu expression increased amount, abnormal	kif5ba^ae11/+; kif5ba^ae12/+ (AB)	standard conditions	Fig. 6 from Campbell et al., 2015
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12; ba2Tg	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
Meckel's cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
Meckel's cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
trunk skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
caudal fin skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
palatoquadrate cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
ceratohyal cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, exacerbated	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
head flattened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
extraocular musculature M band morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
ceratohyal cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/+	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
chondrocyte endoplasmic reticulum position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
whole organism Ab3-mtor labeling decreased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
whole organism ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	control	Fig. 5 from Santos-Ledo et al., 2017
TOR signaling decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte degenerate, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte vacuole increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	chemical treatment by environment: ammonium chloride	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
palatoquadrate cartilage chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
Meckel's cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
Meckel's cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
perichondral bone autophagy occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 , Fig. 2 from Santos-Ledo et al., 2017
chondrocyte rough endoplasmic reticulum distended, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
trunk skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte mitochondrion position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
caudal fin skeletal muscle cell broken, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
palatoquadrate cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
perichondrium disorganized, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
whole organism ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	chemical treatment by environment: ammonium chloride	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage shortened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
mandibular arch skeleton protruding, exacerbated	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
palatoquadrate cartilage chondrocyte circular, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
head flattened, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
extraocular musculature M band morphology, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. S1 from Santos-Ledo et al., 2017
chondrocyte ab3-map1lc3b labeling increased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	control	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage curved, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 1 from Santos-Ledo et al., 2017
perichondral bone bone mineralization decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
entopterygoid decreased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
chondrocyte centrosome polarity, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
perichondral bone autophagy occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
dentary decreased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
branchiostegal ray decreased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
chondrocyte lysosome increased size, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
endochondral bone bone mineralization decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 3 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 2 from Santos-Ledo et al., 2017
chondrocyte centrosome position, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte ab8-rps6 labeling decreased amount, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
ceratohyal cartilage apoptotic process increased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
chondrocyte apoptotic process increased occurrence, abnormal	kif5ba^ae12/ae12; kif5bb^ae24/ae24; ba2Tg	standard conditions	Fig. 5 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton decreased size, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	gpc4^fr6/fr6; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte morphology, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte extracellular matrix ab1-col2a labeling spatial pattern, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton decreased size, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
mandibular arch skeleton chondrocyte position, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017
chondrocyte secretion decreased occurrence, abnormal	wnt5b^ta98/ta98; kif5ba^ae12/ae12; kif5bb^ae24/ae24	standard conditions	Fig. 4 from Santos-Ledo et al., 2017

Citations