Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ae11

ID
ZDB-ALT-160120-2
Name
ae11
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Marlow Lab
Current Source
Other Pages
Note
The ae11 allele of kif5ba has a 5 base pair (bp) deletion predicted to produce a premature stop codon. (Campbell et al. ZDB-PUB-150809-7 ). Homozygotes are viable and fertile. Mkif5ba and MZkif5ba adult mutants are sterile males.
The ae11 allele of kif5ba has a 5 base pair (bp) deletion predicted to produce a premature stop codon. (Campbell et al. ZDB-PUB-150809-7 ). Homozygotes are viable and fertile. Mkif5ba and MZkif5ba adult mutants are sterile males.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 43739245 - 43739249 (GRCz11) (1) Details
Nucleotide change
CACGA/-
Variant Notes
The ae11 allele of kif5ba has a 5 base pair (bp) deletion predicted to produce  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
AAGGTTTTCGACAGAACAGATCTATTTCCCTTAGTATTTACGAGCAACCAGAAAAATAAACAGTTTCCTGCTCATTCGTCATATATCCACAACGAGCCTTGCAATTAGAGGCTCAGACTAATAATATAAGCCTTTGGTTTGTAAACAATCCATATCCTTAAATGAAGGAGTTACAATAAGTGAGCAAGTTTGTGTTTTTCTGGGAGTGTATACCTCACTGTTTCCGCGTTGATCGTGCAGATCGGGCTAGCAAAGTTAGCATGAAGCTCATGAGGAAACAACATAAAATTTTACGAAATTAACAATTATACCCGAATAAAACGGTCTGTTTCGGGTGTCACTGGACCGGAGGCAGGGTCTGGTGTCGGTGTCAAATATTGAGGTCACTACAAATACCGGTTCTACTGGGCTGCGGTCATTAGCATTAGCCGTTCGCGCGGACCAACTGGAAAAATAAAGCATAAAAAATAACCCTGTCCCAAAATAAAACTCACCCCGAT
CACGA/- CGCTATCCTGTCCCTGAAAGTTGGGGATGTATTTGTCTCCCCTTGTCACCTCCGAGCTGTTCAACGGCCTGAAACGGCACATGACTTTAATGGTGCACTCCGCCGGGTCCGCCATCTTCCCCCGGTTACCGAATCACGAGAGCACCGGCCAGAACACACGCACATAGACGGATACAGACACGGACGGAGGGGTGGGGACACCGCCTCACTCCAAAATCCCGGCCTGTGCTGTCGATTCCCGGCCCGTGTGACTGCACAGAAAGAGACGCGTTGGAGGATCACCCGGCCTCCGGTCCGGTGACGTCACATCACGCGCCGTCATCAAGAGCAAAAAAAAAAAAACAGTTCACAGCCGTTGATTTGAGTTATATAGCTTTCTTGTAATGCTCTTATTTATTTATTTATTTATTTTCATACACTTTTATACAATTCTAATTTATTTACCCCTTTCTTTGTTTTGTTAATTTTTTAAACTTTCTGTAGCTAATGTAGCTTGTTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations