Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ae12

ID
ZDB-ALT-160120-3
Name
ae12
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Marlow Lab
Current Source
Other Pages
Note
The ae12 allele of kif5ba has a 6 bp deletion predicted to delete two amino acids. (Campbell et al. ZDB-PUB-150809-7). Homozygotes are viable and fertile. Mkif5ba and MZkif5ba adult mutants are sterile males.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 43739241 - 43739246 (GRCz11) (1) Details
Nucleotide change
CGATCA/-
Variant Notes
The ae12 allele of kif5ba has a 6 bp deletion predicted to delete two amino  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp deleted (1)
Transcript Consequence
None
Protein Consequence
Amino Acid Deletion: 2 AA missing (1)
Sequences
Flanking Sequence
GGAAAAGGTTTTCGACAGAACAGATCTATTTCCCTTAGTATTTACGAGCAACCAGAAAAATAAACAGTTTCCTGCTCATTCGTCATATATCCACAACGAGCCTTGCAATTAGAGGCTCAGACTAATAATATAAGCCTTTGGTTTGTAAACAATCCATATCCTTAAATGAAGGAGTTACAATAAGTGAGCAAGTTTGTGTTTTTCTGGGAGTGTATACCTCACTGTTTCCGCGTTGATCGTGCAGATCGGGCTAGCAAAGTTAGCATGAAGCTCATGAGGAAACAACATAAAATTTTACGAAATTAACAATTATACCCGAATAAAACGGTCTGTTTCGGGTGTCACTGGACCGGAGGCAGGGTCTGGTGTCGGTGTCAAATATTGAGGTCACTACAAATACCGGTTCTACTGGGCTGCGGTCATTAGCATTAGCCGTTCGCGCGGACCAACTGGAAAAATAAAGCATAAAAAATAACCCTGTCCCAAAATAAAACTCACCC
CGATCA/- CGACGCTATCCTGTCCCTGAAAGTTGGGGATGTATTTGTCTCCCCTTGTCACCTCCGAGCTGTTCAACGGCCTGAAACGGCACATGACTTTAATGGTGCACTCCGCCGGGTCCGCCATCTTCCCCCGGTTACCGAATCACGAGAGCACCGGCCAGAACACACGCACATAGACGGATACAGACACGGACGGAGGGGTGGGGACACCGCCTCACTCCAAAATCCCGGCCTGTGCTGTCGATTCCCGGCCCGTGTGACTGCACAGAAAGAGACGCGTTGGAGGATCACCCGGCCTCCGGTCCGGTGACGTCACATCACGCGCCGTCATCAAGAGCAAAAAAAAAAAAACAGTTCACAGCCGTTGATTTGAGTTATATAGCTTTCTTGTAATGCTCTTATTTATTTATTTATTTATTTTCATACACTTTTATACAATTCTAATTTATTTACCCCTTTCTTTGTTTTGTTAATTTTTTAAACTTTCTGTAGCTAATGTAGCTTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations