Community Action Needed: Please respond to the NIH RFI
ZFIN ID: ZDB-SSLP-980528-2007

Mapping Details

SSLP: z22523
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 40.9 cM z22523 Boston MGH Cross (MGH) Fishman, Mark C. Data
5 119.77 cR Z22523 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
5 44.0 cM z22523 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
bmp10 GENE 5 Bland, 2001 Bland (2001) mapped bmp10 onto the LN54 panel between the SSLP markers z22523  ...
z20951 SSLP 5 Bland, 2001 Bland (2001) mapped bmp10 onto the LN54 panel between the SSLP markers z22523  ...
gbgt1l4 GENE 5 Hirata et al., 2012 Hirata, et al. (2012. J Biol Chem. 287:1080-9.) used meiotic mapping to map  ...
mtmr2 GENE 5 Hirata et al., 2012 Hirata, et al. (2012. J Biol Chem. 287:1080-9.) used meiotic mapping to map  ...
mi264 Feature 5 Hirata et al., 2012 Hirata, et al. (2012. J Biol Chem. 287:1080-9.) used meiotic mapping to map  ...
gja2 GENE 5 1.03 cM Hirata et al., 2012 Hirata, et al. (2012. J Biol Chem. 287:1080-9.) used meiotic mapping to map  ...
glra4b GENE 5 0.0 cR Imboden et al., 2001 Imboden, et al. (2001. Dev Genes Evol 211:415-422.) report mapping glra4b to LG05 0.00cR from z22523 on the LN54 mapping panel.
fk59e08 EST 5 Totong et al., 2011
sk38 Feature 5 Totong et al., 2011
fb14b05 EST 5 Totong et al., 2011
cemip2 GENE 5 Totong et al., 2011
z61852 SSLP 5 Totong et al., 2011

OTHER MAPPING INFORMATION
Chr 5 Bland, 2001 Bland (2001) mapped bmp10 onto the LN54 panel between the SSLP markers z22523 and z2095l on LG5.
Chr 5 Totong et al., 2011
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 188,182 60.0
Forward Primer CTCCACTGCCATCTGACTGA
Reverse Primer TGCATCTTACGCTTTGTTGC
IND 182,0,164 60.0
Forward Primer CTCCACTGCCATCTGACTGA
Reverse Primer TGCATCTTACGCTTTGTTGC
EKW 192,0,188 60.0
Forward Primer CTCCACTGCCATCTGACTGA
Reverse Primer TGCATCTTACGCTTTGTTGC
TU 188,162 60.0
Forward Primer CTCCACTGCCATCTGACTGA
Reverse Primer TGCATCTTACGCTTTGTTGC