Genomic Feature

mi264

ID
ZDB-ALT-120202-4
Name
mi264
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Kuwada Lab
Current Source
Other Pages
Note
Missense mutation (E103K) is found in an intracellular loop between membrane domains 2 and 3.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 23634990 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
Missense mutation (E103K) is found in an intracellular loop between membrane  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Glu>Lys at position 103 (1)
Sequences
Flanking Sequence
CATTGGTGTGAAAGGCACTTATATCACGTTTCAATTAACTTGCGCAGCTTCCTCTGCCTTTTCCCCTTCTTTATAGTTCTCTAGAAATTGTAACTGAAAGCAGATGATTCATTAAAAATGCTTAAATTCAGTTGAGCCAGAAATGTACGCAATACTGATTTCTGCATGTATCTGCAGGTGGATGCACTGCAGCGATGGGAGACTTTAGCTCTCTTGGGAAGCTTTTAGAAAGCGCCCAGGAACATTCTACAGTGGTGGGCAAAGTCTGGCTCACCGTCCTATTCATCTTCCGTATCTTGGTGCTCAGTGCTGCCGCAGAGAAGGTTTGGGGTGACGAGCAGTCTGGCTTCACCTGTGACACCAAACAACCTGGTTGTCAGAATGTGTGTTACGATGTAACCTTCCCCATCTCTCACATCCGATTCTGGGTGCTCCAGATCATCTTCGTCTCAACCCCAACACTGATCTATCTGGGCCATATCCTCCACCTGGTGCGCATG
G/A AGCAAAAACTAAAAAGCAATGAAACAAGCGGAGCAGACAAACAAGCACTTCTGGGCCACAAACCAAAAGGTCCCATACGTGATGAACAGGGGAAGATCTGTCTGAAGGGAGTCTTGCTGCGCACGTATGTCTTCAACATCATCTTCAAAACACTGTTTGAGGTGGGCTTCATTGTGGCACAGTATTTCCTCTATGGATTTGAGCTCAAGCCTCTGTACACCTGCAGCAGGTGGCCTTGCCCAAACACTGTCAACTGCTACATCTCGAGACCGACAGAAAAAACCATCTTCATTATTTTCATGCTGGCCGTAGCCTGTGTCTCTCTGCTGCTCAACCTGGTGGAGATGTATCACCTGGGCTTTACCAAGTGCAGACAGGGTCTCCGTTACCGGCGTGCTCACTCAGTCTGCGACACTGAGTCTAAAGTGCCTAGTGAGGACGTTGTTGTTCCTTTTGTGCAAAATTACCCTTATTTTCCTGCTCACGCACCTCCTCCGGCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations