ZFIN ID: ZDB-GENE-980526-290

Mapping Details

Gene Name:	homeobox B1b
Symbol:	hoxb1b

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	12	28,937,421 - 28,956,008	GRCz12tu
NCBI Map Viewer	12	28,937,421 - 28,956,008	GRCz12tu
Ensembl	12	27,141,140 - 27,142,834	GRCz11
NCBI Map Viewer	12	27,141,140 - 27,142,834	GRCz11
UCSC	12	-	GRCz11
Vega	12	27,049,780 - 27,051,474	GRCv10

Mapped Clones containing hoxb1b
BUSM1-227H09	Chr: 12 Details
DKEY-11C5	Chr: 12 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	Citations
b1219	12	27,141,787	GRCz11	DIRECT	Miller et al., 2013
e2214	12	28,955,049 - 28,955,050	GRCz12tu	DIRECT	Moriyama et al., 2025
um195	12	27,141,734 - 27,141,741	GRCz11	DIRECT	Weicksel et al., 2014
um196	12	27,141,736 - 27,141,741	GRCz11	DIRECT	Weicksel et al., 2014
um197	12	27,141,724 - 27,141,740	GRCz11	DIRECT	Weicksel et al., 2014
b1219	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
fh095	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
fh286	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
hoxb1b_unrecovered	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
tud17Gt	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ua1006	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
um195	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
um196	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data
um197	12		GRCz11	OTHER_MAPPING	ZFIN Curated Data

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
12	226.68 cR	hoxa1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
12	3414.0 cR	hoxb1b	Goodfellow T51 (T51)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
hoxb8b	GENE	12		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
hoxb6b	GENE	12		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
hoxb5b	GENE	12		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
mir10a	MIRNAG	12		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.
hoxb5b	GENE	12		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.

Chr 12	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, ...
Chr 12	Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between ...

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	693	AluI	36.0
Forward Primer	GACAGTGACAGCGACTCCAA
Reverse Primer	TAATTGACCGGACGACAACA

Genomic Feature b1219 is an allele of hoxb1b