Mapping Details

Genome Browser Chr Position Assembly ZFIN 12 28,937,421 - 28,956,008 GRCz12tu NCBI Map Viewer 12 28,937,421 - 28,956,008 GRCz12tu Ensembl 12 27,141,140 - 27,142,834 GRCz11 NCBI Map Viewer 12 27,141,140 - 27,142,834 GRCz11 UCSC 12 - GRCz11 Vega 12 27,049,780 - 27,051,474 GRCv10

Mapped Clones containing hoxb1b
BUSM1-227H09	Chr: 12 Details
DKEY-11C5	Chr: 12 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
12	226.68 cR	hoxa1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
12	3414.0 cR	hoxb1b	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
hoxb8b	GENE	12		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
hoxb6b	GENE	12		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
hoxb5b	GENE	12		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.
mir10a	MIRNAG	12		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.
hoxb5b	GENE	12		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.

OTHER MAPPING INFORMATION

Chr 12 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b,  ... Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12.   Chr 12 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between  ... Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	693	AluI	36.0
Forward Primer	GACAGTGACAGCGACTCCAA
Reverse Primer	TAATTGACCGGACGACAACA