Transcript

sltm-007

ID
ZDB-TSCRIPT-090929-10791
Name
sltm-007
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028284 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028284|OTTDARG00000022050|ZDB-GENE-040426-2647 sltm|no_translation sltm-007 LG_ AL935053.6 Danio rerio protein_coding KNOWN, 740 bp
GAGAGAACGTCAAAGGCTGGAAGTGGAAAGACAAAAACTA
GAACGCGAGCGCATGGAGAGAGAGAGACTGGAACGGGAGC
GGATTCGAATAGAGCAGGAGCGACGCAAGGAAGCAGAGCG
TTTGGCTCGTGAACGCGAGGAACTAAGACGACAACAGGAA
CAGCTGCGTTACGAGCAGGAGAAACGAAACAACTTAAAGA
GGGGACGTGATGTTGACCAGAGGAGGGACGATCCATACTG
GAATAGTGCTAAAAAGATGGCAACTGAGCCAGAGGGCCGG
ATTAGTCAAGGTGGTGACTACAACAGCAGACAACAAAACC
GTTTTAATGATTTCAACGCCAGAGACCGCAACCGGTACCC
ACAGTCCTCTGCTGTGCAGTCCAACAACTTTGATAGACGT
AACCGCTTTGTTAACGAAGCTGATTCAAAGAAGAATCGAC
CCGCTCCACGTCGTGAAGGCTCTGGCTTTGAACGATATCC
TAAAGACTTTGAAACTGTACGGAGAGCAGAACAACCGCCT
CCACCTCGTGCAGAGCTCCGAGACAGTGATCGACGAGAGA
TTCGAGATCGTGATGAGCGCAGACAGGTGTCCATGCCTGA
TCGAGCATCTGGAGGCAGAGCACCACCTCCTGCCATTGCC
CACTCCCGCACCCCCAGAGACGGCAGCCATGCTGGCTGGA
AGAATGATGGAGGAATGAATACGAAGCAAGATGTCAGGTA
TGGTAGATCTTCTAATGTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations