Transcript

sltm-207

ID
ZDB-TSCRIPT-090929-10785
Name
sltm-207
Previous Names
  • sltm-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028278 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028278|OTTDARG00000022050|ZDB-GENE-040426-2647 sltm|OTTDARP00000023127 sltm-001 LG_ AL935053.6 Danio rerio protein_coding KNOWN, 3466 bp
GTTGGTACTGTTAGTTGGAGTGTGTCGCTGTCGAGCTCTT
CGCCTCGCACACAGATTTAGTTACACAGGTAAAATGGCGT
CGGGGGCCATTTCAGCGGAGACTAAGAAGATTACAGATTT
ACGTGTTGTGGACCTCAAATCAGAGCTCAAACGAAGAAAT
TTGGATGTGAGCGGGGTGAAAAACACACTGATCGCAAGAC
TGAAGCAGGCCATAGAAGATGAAGGTGGTGATCCAGACAA
CATTGAGATCACCATGTCAGCTGACACACCCACCAGAAAA
TACGGCAAGTCTAAAGGAAAAAAGACAGAGCTGGACACTG
ATACCACCATGGAGGAGGAGTCCTTCTCTAAGGAGACCGA
GGAAGAGGAATCTGAAAAAGATGTAACTGATACTGATGAT
GCTACTCGTGACATTTCTAAAACCTTCTCCTGCGAAGACG
GCCTTGCGGAGCCTGAGGTTGAGGCAGGAGTGGAGCCTGA
TCTTGAGGCTGAGGCAGAAGTGGAGCCCGAGCCTGATCCT
GATGCAGAGATTGAGGCAGAGCGAGAAGCTGATCCTGAAA
CCCCAGCGCTGGAGGCCATGGAGAGTGAGCCTGCTCCTGA
ACCCCTGAAAGAAGTTGAGGATGACAATATATCTGTCACC
ATCCAGGCTGAAGATGCCATCACACTAGATGTGGATGGCG
ACGACCTCCTGGAAACAGGTAAACATGTGAAAATTCCAGA
TTCTGAGGCAGACAAGTGCTGCGAAGAGCCTGAGGCCACT
GCTGAGATGGGGCAGGAGACAGACTCTCTGACTAAAGTAA
TAGAAGGCCACAAGGATGGTAAGAGAGATGACGGGCTGAA
GTCTGACACCGCCAAGAAGGACAGCAGAGAGGCCTCGAAG
AAAGGAGAAACGGGAGACAAGGAAAAGGATTCTGGGAAGA
AAGGCCCCTCTTCAACTGGGGCAACAGGTCAAGCAAAGAG
CTCTTCAAAAGACAGAGATGGAAAGGCTGCGAAAGATGAA
AAAGGAAGTGGCAGCAGCAGTACCAGCTCTACTCGCAATC
TGTGGGTGAGTGGCCTATCATCCAACACCAAAGCAGCTGA
TCTCAAGAACCTCTTTGGCAAATATGGAAAGGTTTTTAGT
GCCAAAGTGGTCACCAATGCTCGTAGCCCAGGAGCTAAAT
GTTATGGATTAGTTACCATGTCGTCCAGTGCAGAAGTGGC
CAGGTGCATCTCTCATTTGGACCGCACAGAACTCCATGGA
CAACAAATATCTGTGGACAGGGTGAAAACTGACCCATTTA
AAAAGGACTTCTCAAAAAAAGAGGCAGAAGAAAAGGCGGC
TTCCATTAAAATTTCTGGAGAAAAGCGCACTCCAGTTGGA
GCAAAACCTTCCAGCAAGACTCCAGTTTCATCTAAGAAAG
AGGAAAAGAAATCAGACAAACCCTTCGAGAAGGACAGCAA
AGACATCAAAAAACAGGACTCCAAAAGCAACAAATCTGAT
GCACCTTCCAATTCTGGACCAGAGGCAGCAAAGAAAGATG
ACAAGAAACATGGACGAAAGAGTCCAGGCAATACAGTGCT
CAACCAACCTAAAGGAGAGCAAATCTTCAATAAATCTCGT
CCTCCTTTTAGAAGGGGTGGGAGGTTTGAGAAGCCTGGTC
CACCCAACATGATGAACAGACGCCCCAGATGGTTCGGACC
ACCTGATGAGATGGAGATGATGAAGAAAGGGCGTCCCATG
CCTAACAAAGGTGGCAATATTGAAATCCTGCCATTTGAGA
AGATTAAGGAACAGCGAATGCGTGAGCGCATGATCAGGAT
GGAACGTGCTCGCAGGGCTGTGGAACTGCGCAGACGACGC
GAAGTAGCAGAGCGGGAGCGCAGAGAGCGAGAGCGTATTC
GTGTTATGCGTGAGCGTGAAGAAAGGGAGAACCTAATGAG
AGAACGTCAAAGGCTGGAAGTGGAAAGACAAAAACTAGAA
CGCGAGCGCATGGAGAGAGAGAGACTGGAACGGGAGCGGA
TTCGAATAGAGCAGGAGCGACGCAAGGAAGCAGAGCGTTT
GGCTCGTGAACGCGAGGAACTAAGACGACAACAGGAACAG
CTGCGTTACGAGCAGGAGAAACGAAACAACTTAAAGAGGG
GACGTGATGTTGACCAGAGGAGGGACGATCCATACTGGAA
TAGTGCTAAAAAGATGGCAACTGAGCCAGAGGGCCGGATT
AGTCAAGGTGGTGACTACAACAGCAGACAACAAAACCGTT
TTAATGATTTCAACGCCAGAGACCGCAACCGGTACCCACA
GTCCTCTGCTGTGCAGTCCAACAACTTTGATAGACGTAAC
CGCTTTGTTAACGAAGCTGATTCAAAGAAGAATCGACCCG
CTCCACGTCGTGAAGGCTCTGGCTTTGAACGATATCCTAA
AGACTTTGAAACTGTACGGAGAGCAGAACAACCGCCTCCA
CCTCGTGCAGAGCTCCGAGACAGTGATCGACGAGAGATTC
GAGATCGTGATGAGCGCAGACAGGTGTCCATGCCTGATCG
AGCATCTGGAGGCAGAGCACCACCTCCTGCCATTGCCCAC
TCCCGCACCCCCAGAGACGGCAGCCATGCTGGCTGGAAGA
ATGATGGAGGAATGAATACGAAGCAAGATGTCAGACCAGT
TCAGATACGTCAGGAACGTCCAGGGCGAGACGGTCCTGGA
CCTGCCATGAGAGGGGTGTCCTCAGCCAGCCGTGGCAGAA
GCAGCTTCAACAGCCGAGATGGCAGAGCTGTGGTTATGGG
AGAGCAGTCGCACTTTAGCAGTGGCAGGCAGGTGGTGGTA
GAGAGACATGGACGTGATCAGGGCCCCAGGAAAGAATGGC
ACGGGGCTGGTGGTTCACAGAGCGGTGGATTCACAGATAA
CCGCCGGATGGGAGACAGTCGGCCTGGCATGATGGCTTCA
CACTCCAGTCATTCCTCCACTGGTATAAACAGAATTGTGC
AGATCACTAATGTTCCGATGACCGGCAGCAGCGGAGGATT
CAAGCCCTTTAAAGGAAGGTTCTAGCATCTTTGCACCAGG
AAATATGAATATTTTTTTTATTGTTATTTTTTTAATTTAG
ATCTCCTGATGTTTTTAAACGGCTAAAAGTATATATAGCC
AGAAGGTTATTGTAAAGATTTGGTTTGGTTGGCTCTTGTT
GTGTGTAAAAGGCTTTACATGTAGGTTTTTTGTTTCCTGA
ACTGTTCTCTGGTGACCTGTAAACAACCTTTGTGCACAAA
CATGTTCTCCTGACACACTGTAGGTGCAGCTTGTACAGCT
TATTTCTTAACCAGTGTTTGTTTAGATAACCTTGACACGT
TGTTCCAGATACTCTCATATGCTTTGGTCGAACTACTGTG
TGTAGCACTGGACACATCTGTTATTCCAGTAACATTTCAA
TATGTGACCCCCTTTTTGATGATGATGACTATTCTACAAG
TTGATATTAAATTATGTGGATTATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations