Transcript

sltm-205

ID
ZDB-TSCRIPT-090929-10787
Name
sltm-205
Previous Names
  • sltm-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028280 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028280|OTTDARG00000022050|ZDB-GENE-040426-2647 sltm|no_translation sltm-003 LG_ AL935053.6 Danio rerio protein_coding KNOWN, 449 bp
ACAGATTTAGTTACACAGGTAAAATGGCGTCGGGGGCCAT
TTCAGCGGAGACTAAGAAGATTACAGATTTACGTGTTGTG
GACCTCAAATCAGAGCTCAAACGAAGAAATTTGGATGTGA
GCGGGGTGAAAAACACACTGATCGCAAGACTGAAGCAGGC
CATAGAAGATGAAGGTGGTGATCCAGACAACATTGAGATC
ACCATGTCAGCTGACACACCCACCAGAAAATACGGCAAGT
CTAAAGGAAAAAAGACAGAGCTGGACACTGATACCACCAT
GGAGGAGGAGTCCTTCTCTAAGGAGACCGAGGAAGAGGAA
TCTGAAAAAGACGGCCTTGCGGAGCCTGAGGTTGAGGCAG
GAGTGGAGCCTGATCTTGAGGCTGAGGCAGAAGTGGAGCC
CGAGCCTGATCCTGATGCAGAGATTGAGGCAGAGCGAGAA
GCTGATCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations