Transcript

sltm-004

ID
ZDB-TSCRIPT-090929-10788
Name
sltm-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028281 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028281|OTTDARG00000022050|ZDB-GENE-040426-2647 sltm|no_translation sltm-004 LG_ AL935053.6 Danio rerio protein_coding KNOWN, 445 bp
TTAGTTACACAGGTAAAATGGCGTCGGGGGCCATTTCAGC
GGAGACTAAGAAGATTACAGATTTACGTGTTGTGGACCTC
AAATCAGAGCTCAAACGAAGAAATTTGGATGTGAGCGGGG
TGAAAAACACACTGATCGCAAGACTGAAGCAGGCCATAGA
AGATGAAGGTGGTGATCCAGACAACATTGAGATCACCATG
TCAGCTGACACACCCACCAGAAAATACGGCAAGTCTAAAG
GAAAAAAGACAGAGCTGGACACTGATACCACCATGGAGGA
GGAGTCCTTCTCTAAGGAGACCGAGGAAGAGGAATCTGAA
AAAGGTATGTTTGGTCACTTATTAGGGTGGAGATTTTTGT
TTTTCAGGTTACAGAAGTTTGGACTTTTTGCTTTCTTTTT
CTTTTGCTGGTTTTCTGTTTCAAAAAAAAAAAAAAAAAAA
AAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations