Transcript

sltm-005

ID
ZDB-TSCRIPT-090929-10789
Name
sltm-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028282 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028282|OTTDARG00000022050|ZDB-GENE-040426-2647 sltm|no_translation sltm-005 LG_ AL935053.6 Danio rerio protein_coding KNOWN, 1125 bp
CCAGTGAAGTCATTCTCTCTCAAGTTGAACACCCTCCTGA
GGATGTCATTGGTCAAGGGAATAAATTGGCAGAAAACCTG
ACCCACCTTGCTCCTGTGGAAAAGCAAGAAAAAGAAGCCT
TATTGGAGTTTTTGTCCGAATGCAAGCCTTGCCTATGGGG
ATTTATTTTTTCGTTCTTTTCCTTTTCTGTAATGCACCAA
ACATTTGTATAACCTTTGTTGTTTGTTTGTTTGGAGCTGT
ACCTCGGTGCCCAAAGTCTTCTCTCATGCGCTTGTACTCA
TTACAGTATTTCTCTCTTCTTTTCGCTCTTGTAATATTCA
CATTTTAGCTCTTCAAAAGACAGAGATGGAAAGGCTGCGA
AAGATGAAAAAGGAAGTGGCAGCAGCAGTACCAGCTCTAC
TCGCAATCTGTGGGTGAGTGGCCTATCATCCAACACCAAA
GCAGCTGATCTCAAGAACCTCTTTGGCAAATATGGAAAGG
TTTTTAGTGCCAAAGTGGTCACCAATGCTCGTAGCCCAGG
AGCTAAATGTTATGGATTAGTTACCATGTCGTCCAGTGCA
GAAGTGGCCAGGTGCATCTCTCATTTGGACCGCACAGAAC
TCCATGGACAACAAATATCTGTGGACAGGGTGAAAACTGA
CCCATTTAAAAAGGACTTCTCAAAAAAAGAGGCAGAAGAA
AAGGCGGCTTCCATTAAAATTTCTGGAGAAAAGCGCACTC
CAGTTGGAGCAAAACCTTCCAGCAAGACTCCAGTTTCATC
TAAGAAAGAGGAAAAGAAATCAGACAAACCCTTCGAGAAG
GACAGCAAAGACATCAAAAAACAGGACTCCAAAAGCAACA
AATCTGATGCACCTTCCAATTCTGGACCAGAGGCAGCAAA
GAAAGATGACAAGAAACATGGACGAAAGAGTCCAGGCAAT
ACAGTGCTCAACCAACCTAAAGGAGAGCAAATCTTCAATA
AATCTCGTCCTCCTTTTAGAAGGGGTGGGAGGTTTGAGAA
GCCTGGTCCACCCAACATGATGAACAGACGCCCCAGATGG
TTCGGACCACCTGATGAGATGGAGATGATGAAGAAAGGGC
GTCCCATGCCTAACAAAGGTGGCAATATTGAAATCCTGCC
ATTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations