header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-180606-1
TALEN Name: TALEN1-nr2f1a
Target: nr2f1a (1)
Previous Name: TALEn1-nr2f1a

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence 1:
5' - TGCCAATATTGTCGGCTGAA - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TATTCACCTTCCCGCCGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-nr2f1a No data available
GENOMIC FEATURES CREATED WITH TALEN1-nr2f1a
Genomic Feature Affected Genomic Regions    
el512 nr2f1a    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-nr2f1a No data available
PHENOTYPE
Phenotype resulting from TALEN1-nr2f1a
No data available

Phenotype of all Fish created by or utilizing TALEN1-nr2f1a
Phenotype Fish Conditions Figures
atrioventricular canal bmp4 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrium decreased size, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrium decreased size, abnormal nr2f1ael512/el512 chemical treatment by environment: dorsomorphin Fig. S3 with image from Duong et al., 2017
atrioventricular canal spp1 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrium cardiac muscle cell decreased amount, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrium cardiac muscle cell decreased amount, abnormal nr2f1ael512/el512 chemical treatment by environment: dorsomorphin Fig. S3 with image from Duong et al., 2017
hindbrain nr2f1a expression absent, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
atrioventricular canal has2 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
pharyngeal arch nr2f1a expression absent, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
atrioventricular canal klf2a expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal klf2a expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrium myh6 expression decreased amount, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
cardiac ventricle myh7 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
cerebellum nr2f1a expression absent, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
atrioventricular canal tbx2b expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal spp1 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal tbx2b expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
pericardium edematous, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
atrioventricular canal has2 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
cardiac ventricle myh7 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrioventricular canal notch1b expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal bmp4 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal notch1b expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
endocardial cushion cell increased amount, abnormal f2Tg ; nr2f1ael512/el512 chemical treatment by environment: dorsomorphin Fig. 4 with image from Duong et al., 2017
atrioventricular canal increased size, abnormal f2Tg ; nr2f1ael512/el512 chemical treatment by environment: dorsomorphin Fig. 4 with image from Duong et al., 2017
atrial cardiac muscle cell differentiation disrupted, abnormal sd22Tg ; nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
neural crest cell migration decreased occurrence, abnormal nr2f5el611/el611 ; nr2f1bel523/el523 ; nr2f2el506/el506 ; nr2f1ael512/el512(TU) standard conditions Fig. 2 with image from Barske et al., 2018
OTHER TALEN1-nr2f1a TALEN PAGES No links to external sites
CITATIONS (3)