TALEN

TALEN1-nr2f1a

ID
ZDB-TALEN-180606-1
Name
TALEN1-nr2f1a
Previous Names
  • TALEn1-nr2f1a
Target
Target Sequence 1
5' - TGCCAATATTGTCGGCTGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - TATTCACCTTCCCGCCGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el512 nr2f1a
Expression
Gene expression in Wild Types + TALEN1-nr2f1a
No data available
Phenotype
Phenotype resulting from TALEN1-nr2f1a
No data available
Phenotype of all Fish created by or utilizing TALEN1-nr2f1a
Phenotype Fish Conditions Figures
atrium decreased size, abnormal nr2f1ael512/el512 chemical treatment by environment: dorsomorphin Fig. S3 with image from Duong et al., 2017
atrioventricular canal bmp4 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
cerebellum nr2f1a expression absent, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
cardiac ventricle myh7 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
heart morphology, abnormal nr2f1ael512/el512 standard conditions Fig. 4 from Dohn et al., 2019
blood accumulation ball, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Dohn et al., 2019
atrioventricular canal has2 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
hindbrain nr2f1a expression absent, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
pericardium edematous, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
atrium decreased size, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrium cardiac muscle cell decreased amount, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrioventricular canal notch1b expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal bmp4 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
pharyngeal arch nr2f1a expression absent, abnormal nr2f1ael512/el512 standard conditions Fig. 1 with image from Duong et al., 2017
atrium cardiac muscle cell decreased amount, abnormal nr2f1ael512/el512 chemical treatment by environment: dorsomorphin Fig. S3 with image from Duong et al., 2017
atrioventricular canal spp1 expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal tbx2b expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrium myh6 expression decreased amount, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrioventricular canal notch1b expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
cardiac ventricle myh7 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 2 with image from Duong et al., 2017
atrioventricular canal tbx2b expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal spp1 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal klf2a expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal has2 expression increased distribution, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
atrioventricular canal klf2a expression spatial pattern, abnormal nr2f1ael512/el512 standard conditions Fig. 3 with image from Duong et al., 2017
endocardial cushion cell increased amount, abnormal nr2f1ael512/el512; f2Tg chemical treatment by environment: dorsomorphin Fig. 4 with image from Duong et al., 2017
atrioventricular canal increased size, abnormal nr2f1ael512/el512; f2Tg chemical treatment by environment: dorsomorphin Fig. 4 with image from Duong et al., 2017
atrium cardiac muscle cell decreased amount, abnormal nr2f1ael512/el512; sd12Tg standard conditions Fig. 4 from Dohn et al., 2019
atrial cardiac muscle cell differentiation disrupted, abnormal nr2f1ael512/el512; sd22Tg standard conditions Fig. 2 with image from Duong et al., 2017
pectoral protractor ab-mf20 labeling decreased amount, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. S7 with image from Dohn et al., 2019
blood accumulation ball, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. 3 with image from Dohn et al., 2019
heart morphology, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. 4 from Dohn et al., 2019
presumptive cardiac ventricle primitive heart tube cardiac muscle cell increased amount, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. 5 with image from Dohn et al., 2019
pectoral protractor decreased size, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. S7 with image from Dohn et al., 2019
pectoral protractor absent, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. S7 with image from Dohn et al., 2019
pericardium edematous, abnormal nr2f1ael512/el512; nr2f2el506/+ standard conditions Fig. 3 with image from Dohn et al., 2019
cardiac ventricle cardiac muscle cell increased amount, abnormal nr2f1ael512/el512; nr2f2el506/+; fb2Tg; pd42Tg standard conditions Fig. 8 from Dohn et al., 2019
cardiac ventricle cardiac muscle cell ZsYellow expression increased amount, abnormal nr2f1ael512/el512; nr2f2el506/+; fb2Tg; pd42Tg standard conditions Fig. 8 from Dohn et al., 2019
pectoral protractor ZsYellow expression decreased amount, abnormal nr2f1ael512/el512; nr2f2el506/+; fb5Tg; pd42Tg standard conditions Fig. 7 with image from Dohn et al., 2019
pectoral protractor absent, abnormal nr2f1ael512/el512; nr2f2el506/+; fb5Tg; pd42Tg standard conditions Fig. 7 with image from Dohn et al., 2019
cardiac ventricle cardiac muscle cell increased amount, abnormal nr2f1ael512/el512; nr2f2el506/+; sd12Tg standard conditions Fig. 4 from Dohn et al., 2019
pectoral protractor decreased size, abnormal nr2f1ael512/el512; nr2f2el506/+; zf13Tg standard conditions Fig. 6 with image from Dohn et al., 2019
pectoral protractor absent, abnormal nr2f1ael512/el512; nr2f2el506/+; zf13Tg standard conditions Fig. 6 with image from Dohn et al., 2019
pectoral protractor GFP expression decreased amount, abnormal nr2f1ael512/el512; nr2f2el506/+; zf13Tg standard conditions Fig. 6 with image from Dohn et al., 2019
blood accumulation ball, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. 3 with image from Dohn et al., 2019
heart morphology, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. 4 from Dohn et al., 2019
heart primordium Ab3-nkx2.5 labeling increased distribution, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. S4 with image from Dohn et al., 2019
heart primordium Ab3-nkx2.5 labeling increased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. S4 with image from Dohn et al., 2019
presumptive cardiac ventricle primitive heart tube cardiac muscle cell increased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. 5 with image from Dohn et al., 2019
pectoral protractor decreased size, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. S7 with image from Dohn et al., 2019
pectoral protractor absent, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. S7 with image from Dohn et al., 2019
pericardium edematous, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. 3 with image from Dohn et al., 2019
pectoral protractor ab-mf20 labeling decreased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506 standard conditions Fig. S7 with image from Dohn et al., 2019
cardiac ventricle cardiac muscle cell ZsYellow expression increased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506; fb2Tg; pd42Tg standard conditions Fig. 8 from Dohn et al., 2019
pectoral protractor ZsYellow expression decreased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506; fb5Tg; pd42Tg standard conditions Fig. 7 with image from Dohn et al., 2019
pectoral protractor absent, abnormal nr2f1ael512/el512; nr2f2el506/el506; fb5Tg; pd42Tg standard conditions Fig. 7 with image from Dohn et al., 2019
cardiac ventricle cardiac muscle cell increased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506; sd12Tg standard conditions Fig. 4 from Dohn et al., 2019
pectoral protractor decreased size, abnormal nr2f1ael512/el512; nr2f2el506/el506; zf13Tg standard conditions Fig. 6 with image from Dohn et al., 2019
pectoral protractor absent, abnormal nr2f1ael512/el512; nr2f2el506/el506; zf13Tg standard conditions Fig. 6 with image from Dohn et al., 2019
pectoral protractor GFP expression decreased amount, abnormal nr2f1ael512/el512; nr2f2el506/el506; zf13Tg standard conditions Fig. 6 with image from Dohn et al., 2019
neural crest cell migration decreased occurrence, abnormal nr2f1ael512/el512; nr2f1bel523/el523; nr2f2el506/el506; nr2f5el611/el611 (TU) standard conditions Fig. 2 with image from Barske et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.