Genomic Feature

el512

ID
ZDB-ALT-180606-9
Name
el512
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Crump Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 5: 49745891 - 49745898 (GRCz11) (1) Details
Nucleotide change
TTTAAAAG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted from position 1119 to 1126 in RefSeq:NM_131180.1 in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GAATTCGCGCTGCCGTTCGTCCAAGACTTCCCTTTTCCCTGCTCCGATATCCGAGCGACCAGTTCGCTTGAAAGCACTTTTCGGGCCCGAGATATGGCAATGGTAGTTAGCGTCTGGCGAGATCCGCAGGAAGACGTGGCTGGAGGACCTCCGAGCGGCCCCAATCCAGCAGCTCAGCCGGCGAGGGAGCAACAGCAGGCGGCGTCAGCGGCACCACACACTCCGCAGACCCCCAGTCAGCCAGGACCTCCGTCCACACCAGGGACGGCTGGCGACAAGGGCAGCCAGAATTCTGGACAGAGTCAACAGCATATAGAATGTGTTGTTTGCGGGGACAAATCAAGCGGCAAGCACTATGGTCAATTCACCTGCGAAGGATGCAAAAGTTTCTTCAAGAGGAGTGTCCGAAGGAACTTAACATATACATGTCGTGCCAACAGGAACTGTCCTATTGACCAACACCATCGTAATCAGTGCCAATATTGTCGGCTGAAGAAGTG
TTTAAAAG/- TGGGCATGCGGCGGGAAGGTGAATATATTTTTCTGAATACATCACACTTGCTACACAAACAGGTTTATTGTTTAAAGCAAGGTTATGCAGACCTCGCAATATTAATATGCAAACGCAAAATACTATCGTATTGAATTATTGCTAAAGAGTGTCAGAGGGCGCGTTTGTAAATACACGCGTATATATGCAAGATCAGCATGGATCTATTATAGTTTTTTTTACATAGATTGGCAAATATCGTATGCACCAATTTCAACTCGCAAATAACAATATATATTATAAAGTCACCCAGTAAACACTGTGTGTGTCAAAAAGAAAGATAAAGATTAAGTGTGTAGCTAAGCCTACGTGCTTTTACGTGTGTGCTGAAAGACGAAAAAGCTAACTACGTTCACATGCACATATAGTGTACCCTATTGAAATAAGAAGCTATAGCCTATGTTTATCTCTCGAAGTAAGATGTACAAGTCTGTTTTCACGCCGTAGCCTAGAGTAAACGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations