TALEN

TALEN1-stat3

ID
ZDB-TALEN-170405-1
Name
TALEN1-stat3
Previous Names
None
Target
Target Sequence 1
5' - TAACCTCTTACTCATCCTCCA - 3'
Target Sequence 2
5' - TTCTCCAACATCTTCATCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
stl27 stat3
stl28 stat3
Expression
Gene expression in Wild Types + TALEN1-stat3
No data available
Phenotype
Phenotype resulting from TALEN1-stat3
No data available
Phenotype of all Fish created by or utilizing TALEN1-stat3
Phenotype Fish Conditions Figures
notochord cell decreased length, abnormal stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
fin regeneration decreased efficacy, abnormal stat3stl27/stl27 amputation: caudal fin Fig. 4 with image from Miskolci et al., 2019
neuromast stat3 expression decreased amount, abnormal stat3stl27/stl27 standard conditions Fig. 1 with image from Liu et al., 2017
notochord cell increased area, abnormal stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
whole organism il6 expression increased amount, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
spinal cord bent, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
whole organism tnfa expression increased amount, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
somite 1 lateral region has fewer parts of type notochord cell, abnormal stat3stl27/stl27 standard conditions Fig. 7 with image from Liu et al., 2017
whole organism cell ab4-h3 labeling decreased distribution, abnormal stat3stl27/stl27 standard conditions Fig. 5 with image from Liu et al., 2017
whole organism stat3 expression decreased amount, abnormal stat3stl27/stl27 standard conditions Fig. 1 with imageFig. 9 with image from Liu et al., 2017
somite 2 lateral region has fewer parts of type notochord cell, abnormal stat3stl27/stl27 standard conditions Fig. 7 with image from Liu et al., 2017
blastomere stat3 expression decreased amount, abnormal stat3stl27/stl27 standard conditions Fig. 1 with image from Liu et al., 2017
mitotic cell cycle increased duration, abnormal stat3stl27/stl27 standard conditions Fig. 6 with image from Liu et al., 2017
head stat3 expression decreased amount, abnormal stat3stl27/stl27 standard conditions Fig. 1 with image from Liu et al., 2017
cell population proliferation decreased occurrence, abnormal stat3stl27/stl27 standard conditions Fig. 5 with image from Liu et al., 2017
bone tissue decreased volume, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
notochord cell increased width, abnormal stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
somite anterior-posterior axis decreased length, exacerbated stat3stl27/stl27 standard conditions Fig. 7 with image from Liu et al., 2017
whole organism cell decreased amount, abnormal stat3stl27/stl27 standard conditions Fig. 5 with image from Liu et al., 2017
bone mineralization decreased occurrence, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
somite adaxial cell decreased amount, exacerbated stat3stl27/stl27 standard conditions Fig. 7 with image from Liu et al., 2017
whole organism decreased life span, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
whole organism cdc25b expression decreased amount, abnormal stat3stl27/stl27 standard conditions Fig. 9 with image from Liu et al., 2017
whole organism decreased life span, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
notochord cell shape, abnormal stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
notochord decreased length, abnormal stat3stl27/stl27 standard conditions Fig. 3 with imageFig. 9 with image from Liu et al., 2017
whole organism decreased length, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
mitotic cell cycle, embryonic decreased occurrence, abnormal stat3stl27/stl27 standard conditions Fig. 5 with image from Liu et al., 2017
whole organism decreased length, abnormal stat3stl27/stl27 standard conditions Fig. 2 with image from Liu et al., 2017
notochord decreased length, exacerbated stat3stl27/stl27 + MO1-stat3 standard conditions Fig. 3 with image from Liu et al., 2017
whole organism decreased length, abnormal stat3stl28/stl28 standard conditions Fig. 2 with image from Liu et al., 2017
notochord cell decreased length, abnormal stat3stl27 standard conditions Fig. 4 with image from Liu et al., 2017
mitotic cell cycle increased duration, abnormal stat3stl27 standard conditions Fig. 5 with image from Liu et al., 2017
somite adaxial cell decreased amount, abnormal stat3stl27 standard conditions Fig. 7 with image from Liu et al., 2017
whole organism cell ab4-h3 labeling decreased distribution, abnormal stat3stl27 standard conditions Fig. 5 with image from Liu et al., 2017
somite 1 lateral region has fewer parts of type notochord cell, abnormal stat3stl27 standard conditions Fig. 7 with image from Liu et al., 2017
whole organism cell decreased amount, abnormal stat3stl27 standard conditions Fig. 5 with image from Liu et al., 2017
notochord cell shape, abnormal stat3stl27 standard conditions Fig. 4 with image from Liu et al., 2017
cell population proliferation decreased occurrence, abnormal stat3stl27 standard conditions Fig. 5 with image from Liu et al., 2017
somite anterior-posterior axis decreased length, abnormal stat3stl27 standard conditions Fig. 7 with image from Liu et al., 2017
mitotic cell cycle, embryonic decreased occurrence, abnormal stat3stl27 standard conditions Fig. 5 with image from Liu et al., 2017
notochord cell increased area, abnormal stat3stl27 standard conditions Fig. 4 with image from Liu et al., 2017
notochord decreased length, abnormal stat3stl27 standard conditions Fig. 3 with image from Liu et al., 2017
notochord cell increased width, abnormal stat3stl27 standard conditions Fig. 4 with image from Liu et al., 2017
somite 2 lateral region has fewer parts of type notochord cell, abnormal stat3stl27 standard conditions Fig. 7 with image from Liu et al., 2017
regenerating fin EGFP expression decreased distribution, abnormal stat3stl27/stl27; uwm37Tg chemical treatment by environment: SB 431542, amputation: caudal fin Fig. 4 with image from Miskolci et al., 2019
fin regeneration decreased efficacy, abnormal stat3stl27/stl27; uwm37Tg chemical treatment by environment: SB 431542, amputation: caudal fin Fig. 4 with image from Miskolci et al., 2019
regenerating fin EGFP expression decreased distribution, abnormal stat3stl27/stl27; uwm37Tg amputation: caudal fin Fig. 4 with image from Miskolci et al., 2019
regenerating tissue hepatocyte decreased amount, abnormal stat3stl27/stl27; s931Tg; s939Tg chemical ablation: hepatocyte, chemical treatment by environment: metronidazole Fig. 6 from Khaliq et al., 2018
liver regenerating tissue ab1-bhmt labeling decreased amount, abnormal stat3stl27/stl27; s931Tg; s939Tg chemical ablation: hepatocyte, chemical treatment by environment: metronidazole Fig. 6 from Khaliq et al., 2018
regenerating tissue hepatocyte differentiation decreased occurrence, abnormal stat3stl27/stl27; s931Tg; s939Tg chemical ablation: hepatocyte, chemical treatment by environment: metronidazole Fig. 6 from Khaliq et al., 2018
regenerating tissue hepatocyte differentiation delayed, abnormal stat3stl27/stl27; s931Tg; s939Tg chemical ablation: hepatocyte, chemical treatment by environment: metronidazole Fig. 6 from Khaliq et al., 2018
regenerating tissue cell population proliferation decreased occurrence, abnormal stat3stl27/stl27; s931Tg; s939Tg chemical ablation: hepatocyte, chemical treatment by environment: metronidazole Fig. 6 from Khaliq et al., 2018
eye fused with eye, abnormal vangl2vu67/vu67; stat3stl27/+ standard conditions Fig. 4 with image from Liu et al., 2017
eye adjacent to eye, abnormal vangl2vu67/vu67; stat3stl27/+ standard conditions Fig. 4 with image from Liu et al., 2017
eye fused with eye, abnormal vangl2vu67/vu67; stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
eye adjacent to eye, abnormal vangl2vu67/vu67; stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
eye fused with eye, abnormal wnt11f2tz216/tz216; stat3stl27/+ standard conditions Fig. 4 with image from Liu et al., 2017
eye adjacent to eye, abnormal wnt11f2tz216/tz216; stat3stl27/+ standard conditions Fig. 4 with image from Liu et al., 2017
eye fused with eye, abnormal wnt11f2tz216/tz216; stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
eye adjacent to eye, abnormal wnt11f2tz216/tz216; stat3stl27/stl27 standard conditions Fig. 4 with image from Liu et al., 2017
Citations