Morpholino

MO2-lpar2b

ID
ZDB-MRPHLNO-180712-1
Name
MO2-lpar2b
Previous Names
None
Target
Sequence
5' - TCTGATTGGCTGAGCTGAAGGGATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lpar2b
No data available
Phenotype
Phenotype resulting from MO2-lpar2b
Phenotype Fish Figures
posterior lateral line neuromast has fewer parts of type hair cell, abnormal s356tTg + MO2-lpar2b Fig. 2 with image from Wang et al., 2018
posterior lateral line primordium ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b Fig. S4 with image from Wang et al., 2018
posterior lateral line primordium prox1a expression decreased amount, abnormal AB + MO2-lpar2b Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased amount, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium cxcr4b expression decreased amount, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased amount, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium ackr3b expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium prox1a expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased distribution, abnormal zf551Tg + MO2-lpar2b Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium decreased size, abnormal AB + MO2-lpar2b Fig. 3 with imageFig. S3 with image from Wang et al., 2018
posterior lateral line primordium has fewer parts of type cell, abnormal zf551Tg + MO2-lpar2b Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium lef1 expression increased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium fgf10a expression increased distribution, abnormal AB + MO2-lpar2b Fig. 3 with image from Wang et al., 2018
pronephric duct ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b Fig. S4 with image from Wang et al., 2018
whole organism has fewer parts of type posterior lateral line neuromast, abnormal zf551Tg + MO2-lpar2b Fig. 2 with imageFig. 6 with image from Wang et al., 2018
Phenotype of all Fish created by or utilizing MO2-lpar2b
Phenotype Fish Conditions Figures
posterior lateral line primordium prox1a expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
pronephric duct ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b standard conditions Fig. S4 with image from Wang et al., 2018
posterior lateral line primordium fgf10a expression increased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium prox1a expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 5 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium ab1-yap1 labeling absent, abnormal AB + MO2-lpar2b standard conditions Fig. S4 with image from Wang et al., 2018
posterior lateral line primordium cxcr4b expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium fgfr1a expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium ackr3b expression decreased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium decreased size, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium etv4 expression decreased amount, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line primordium lef1 expression increased distribution, abnormal AB + MO2-lpar2b standard conditions Fig. 3 with image from Wang et al., 2018
posterior lateral line neuromast has fewer parts of type hair cell, abnormal s356tTg + MO2-lpar2b standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line primordium decreased size, abnormal zf106Tg + MO2-lpar2b standard conditions Fig. 3 with imageFig. S3 with image from Wang et al., 2018
whole organism has fewer parts of type posterior lateral line neuromast, abnormal zf551Tg + MO2-lpar2b standard conditions Fig. 2 with imageFig. 6 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased distribution, abnormal zf551Tg + MO2-lpar2b standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium has fewer parts of type cell, abnormal zf551Tg + MO2-lpar2b standard conditions Fig. 4 with image from Wang et al., 2018
Citations