Morpholino

MO5-prnprs3

ID
ZDB-MRPHLNO-150324-4
Name
MO5-prnprs3
Previous Names
  • start codon (1)
Target
Sequence
5' - ATTGTTAAGCGACCCATCTTTGGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-prnprs3
Expressed Gene Anatomy Figures
prnprs3 Fig. 1 with image,  Fig. 3 with image from Huc-Brandt et al., 2014
Phenotype
Phenotype resulting from MO5-prnprs3
Phenotype Fish Figures
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg + MO5-prnprs3 Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line decreased length, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal WT + MO4-tp53 + MO5-prnprs3 Fig. 1 with image,  Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line increased diameter, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line axon defasciculated, abnormal ba4Tg + MO5-prnprs3 Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line myelinating Schwann cell circular, abnormal ba4Tg; zf148Tg + MO5-prnprs3 Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg + MO5-prnprs3 Fig. 1 with image,  Fig. 2 with image,  Fig. 4 with image,  Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal s356tTg + MO5-prnprs3 Fig. 7 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast mislocalised, abnormal WT + MO5-prnprs3 Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast hair cell differentiation decreased occurrence, abnormal s356tTg + MO5-prnprs3 Fig. 7 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast primordium migration arrested, abnormal zf106Tg + MO5-prnprs3 Fig. 5 with image from Huc-Brandt et al., 2014
posterior lateral line primordium circular, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 Fig. 5 with image,  Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line primordium disorganized, abnormal zf106Tg + MO5-prnprs3 Fig. 4 with image from Huc-Brandt et al., 2014
posterior lateral line primordium adherens junction decreased object quality, abnormal zf106Tg + MO5-prnprs3 Fig. 6 with image from Huc-Brandt et al., 2014
posterior lateral line primordium adherens junction maintenance decreased process quality, abnormal zf106Tg + MO5-prnprs3 Fig. 6 with image from Huc-Brandt et al., 2014
Phenotype of all Fish created by or utilizing MO5-prnprs3
Phenotype Fish Conditions Figures
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal WT + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast mislocalised, abnormal WT + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal WT + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal WT + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal WT + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast mislocalised, abnormal WT + MO5-prnprs3 standard conditions Fig. 2 with image from Huc-Brandt et al., 2014
posterior lateral line increased diameter, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line axon defasciculated, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line primordium circular, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line primordium circular, abnormal ba4Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line axon defasciculated, abnormal ba4Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line increased diameter, abnormal ba4Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast hair cell differentiation decreased occurrence, abnormal s356tTg + MO5-prnprs3 standard conditions Fig. 7 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal s356tTg + MO5-prnprs3 standard conditions Fig. 7 with image from Huc-Brandt et al., 2014
posterior lateral line primordium adherens junction decreased object quality, abnormal zf106Tg + MO5-prnprs3 standard conditions Fig. 6 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal zf106Tg + MO5-prnprs3 standard conditions Fig. 4 with image from Huc-Brandt et al., 2014
posterior lateral line primordium circular, abnormal zf106Tg + MO5-prnprs3 standard conditions Fig. 5 with image from Huc-Brandt et al., 2014
posterior lateral line primordium adherens junction maintenance decreased process quality, abnormal zf106Tg + MO5-prnprs3 standard conditions Fig. 6 with image from Huc-Brandt et al., 2014
posterior lateral line primordium disorganized, abnormal zf106Tg + MO5-prnprs3 standard conditions Fig. 4 with image from Huc-Brandt et al., 2014
posterior lateral line neuromast primordium migration arrested, abnormal zf106Tg + MO5-prnprs3 standard conditions Fig. 5 with image from Huc-Brandt et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line decreased length, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf148Tg + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal zf148Tg + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line decreased length, abnormal zf148Tg + MO5-prnprs3 standard conditions Fig. 1 with image from Huc-Brandt et al., 2014
posterior lateral line increased diameter, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line myelinating Schwann cell circular, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line axon defasciculated, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg; zf148Tg + MO4-tp53 + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line increased diameter, abnormal ba4Tg; zf148Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line axon defasciculated, abnormal ba4Tg; zf148Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line development decreased process quality, abnormal ba4Tg; zf148Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
posterior lateral line myelinating Schwann cell circular, abnormal ba4Tg; zf148Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
myelination of posterior lateral line nerve axons decreased occurrence, abnormal ba4Tg; zf148Tg + MO5-prnprs3 standard conditions Fig. 8 with image from Huc-Brandt et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.