Morpholino

MO4-tnfa

ID
ZDB-MRPHLNO-110621-1
Name
MO4-tnfa
Previous Names
None
Target
Sequence
5' - GCAGGATTTTCACCTTATGGAGCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tnfa
No data available
Phenotype
Phenotype resulting from MO4-tnfa
Phenotype of all Fish created by or utilizing MO4-tnfa
Phenotype Fish Conditions Figures
whole organism life span, ameliorated AB + MO4-tnfa viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 1 from Espín-Palazón et al., 2016
defense response to bacterium disrupted, abnormal AB + MO4-tnfa bacterial treatment: Mycobacterium marinum Fig. 4 with image from Tobin et al., 2012
inflammatory response to antigenic stimulus process characteristic, abnormal AB + MO4-tnfa bacterial treatment: Mycobacterium marinum Fig. 4 with image from Tobin et al., 2012
ventral wall of dorsal aorta myb expression decreased distribution, abnormal WT + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
T cell rag1 expression absent, abnormal WT + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
glial cell EGFP expression absent, abnormal nc1Tg + MO4-tnfa control Fig. 5 with image from Smith et al., 2017
dorsal root ganglion peripheral nervous system axon ensheathment decreased occurrence, abnormal w9Tg + MO4-tnfa control Fig. 4 with image from Smith et al., 2017
glial cell Eos expression decreased amount, abnormal w9Tg + MO4-tnfa control Fig. 4 with image from Smith et al., 2017
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; sd2Tg + MO4-tnfa standard conditions Fig. 2 from Espín-Palazón et al., 2014
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression absent, abnormal la2Tg; sd2Tg + MO4-tnfa standard conditions Fig. 2 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta EGFP expression decreased distribution, abnormal s896Tg; um14Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
autophagy increased occurrence, abnormal zf155Tg + MO4-tnfa control Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa control Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 with image from Espín-Palazón et al., 2016
autophagy increased occurrence, exacerbated zf155Tg + MO4-tnfa viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 with image from Espín-Palazón et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated bw9Tg; kca3Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal kca3Tg; kca4Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal kca3Tg; kca4Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated kca3Tg; kca4Tg + MO4-tnfa heat shock Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
hematopoietic stem cell homeostasis decreased occurrence, abnormal s896Tg; zf169Tg + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
intestinal epithelial cell decreased height, abnormal uhrf1pd1092/pd1092; pd1028Tg + MO4-tnfa standard conditions Fig. 4 with image from Marjoram et al., 2015
Citations