Morpholino

MO4-tnfa

ID
ZDB-MRPHLNO-110621-1
Name
MO4-tnfa
Previous Names
None
Target
Sequence
5' - GCAGGATTTTCACCTTATGGAGCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tnfa
Expressed Gene Anatomy Figures
dlc Fig. 2 from Espín-Palazón et al., 2014
efnb2a Fig. 2 from Espín-Palazón et al., 2014
foxn1 Fig. 1 from Espín-Palazón et al., 2014
kdrl Fig. 2 from Espín-Palazón et al., 2014
myb Fig. 1 from Espín-Palazón et al., 2014
notch1b Fig. 2 from Espín-Palazón et al., 2014
notch3 Fig. 2 from Espín-Palazón et al., 2014
rag1 Fig. 1 from Espín-Palazón et al., 2014
runx1 Fig. 3 from Espín-Palazón et al., 2014
Phenotype
Phenotype resulting from MO4-tnfa
Phenotype Fish Figures
autophagy increased occurrence, abnormal zf155Tg + MO4-tnfa Fig. 7 with image from Espín-Palazón et al., 2016
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression absent, abnormal la2Tg; sd2Tg + MO4-tnfa Fig. 2 from Espín-Palazón et al., 2014
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; sd2Tg + MO4-tnfa Fig. 2 from Espín-Palazón et al., 2014
dorsal root ganglion peripheral nervous system axon ensheathment decreased occurrence, abnormal w9Tg + MO4-tnfa Fig. 4 with image from Smith et al., 2017
glial cell EGFP expression absent, abnormal nc1Tg + MO4-tnfa Fig. 5 with image from Smith et al., 2017
glial cell Eos expression decreased amount, abnormal w9Tg + MO4-tnfa Fig. 4 with image from Smith et al., 2017
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO4-tnfa Fig. 1 from Espín-Palazón et al., 2014
T cell rag1 expression absent, abnormal WT + MO4-tnfa Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta EGFP expression decreased distribution, abnormal s896Tg; um14Tg + MO4-tnfa Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta myb expression decreased distribution, abnormal WT + MO4-tnfa Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO4-tnfa Fig. 1 from Espín-Palazón et al., 2014
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa Fig. 7 with image from Espín-Palazón et al., 2016
Phenotype of all Fish created by or utilizing MO4-tnfa
Phenotype Fish Conditions Figures
inflammatory response to antigenic stimulus process quality, abnormal AB + MO4-tnfa bacterial treatment: Mycobacterium marinum Fig. 4 with image from Tobin et al., 2012
whole organism life span, ameliorated AB + MO4-tnfa viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 1 from Espín-Palazón et al., 2016
defense response to bacterium disrupted, abnormal AB + MO4-tnfa bacterial treatment: Mycobacterium marinum Fig. 4 with image from Tobin et al., 2012
ventral wall of dorsal aorta myb expression decreased distribution, abnormal WT + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
T cell rag1 expression absent, abnormal WT + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
glial cell EGFP expression absent, abnormal nc1Tg + MO4-tnfa control Fig. 5 with image from Smith et al., 2017
dorsal root ganglion peripheral nervous system axon ensheathment decreased occurrence, abnormal w9Tg + MO4-tnfa control Fig. 4 with image from Smith et al., 2017
glial cell Eos expression decreased amount, abnormal w9Tg + MO4-tnfa control Fig. 4 with image from Smith et al., 2017
autophagy increased occurrence, abnormal zf155Tg + MO4-tnfa control Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa control Fig. 7 with image from Espín-Palazón et al., 2016
whole organism EGFP expression increased amount, abnormal zf155Tg + MO4-tnfa viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 with image from Espín-Palazón et al., 2016
autophagy increased occurrence, exacerbated zf155Tg + MO4-tnfa viral treatment by exposure to environment: Sprivivirus cyprinus Fig. 7 with image from Espín-Palazón et al., 2016
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg; sd2Tg + MO4-tnfa standard conditions Fig. 2 from Espín-Palazón et al., 2014
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression absent, abnormal la2Tg; sd2Tg + MO4-tnfa standard conditions Fig. 2 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta EGFP expression decreased distribution, abnormal s896Tg; um14Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated bw9Tg; kca3Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal kca3Tg; kca4Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal kca3Tg; kca4Tg + MO4-tnfa standard conditions Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell amount, ameliorated kca3Tg; kca4Tg + MO4-tnfa heat shock Fig. 3 from Espín-Palazón et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
hematopoietic stem cell homeostasis decreased occurrence, abnormal s896Tg; zf169Tg + MO4-tnfa standard conditions Fig. 1 from Espín-Palazón et al., 2014
intestinal epithelial cell decreased height, abnormal uhrf1pd1092/pd1092; pd1028Tg + MO4-tnfa standard conditions Fig. 4 with image from Marjoram et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.