Morpholino

MO3-obscnb

ID
ZDB-MRPHLNO-100524-1
Name
MO3-obscnb
Previous Names
None
Target
Sequence
5' - CTGAATAATCCTGATGGATAAAAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-obscnb
No data available
Phenotype
Phenotype resulting from MO3-obscnb
No data available
Phenotype of all Fish created by or utilizing MO3-obscnb
Phenotype Fish Conditions Figures
cardiac muscle cell intercalated disc absent, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 7 with image from Raeker et al., 2010
post-vent region decreased length, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
cardiac muscle cell myofibril decreased amount, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 7 with image from Raeker et al., 2010
pericardium edematous, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
skeletal muscle cell M band decreased amount, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 4 with imageFig. 5 with image from Raeker et al., 2010
eye pigmentation disrupted, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 9 with image from Raeker et al., 2010
skeletal muscle cell nucleus shape, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 4 with image from Raeker et al., 2010
optic cup morphology, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
otolith decreased amount, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
retina layer formation disrupted, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 9 with image from Raeker et al., 2010
photoreceptor cell absent, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 9 with image from Raeker et al., 2010
head decreased size, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
eye hypoplastic, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
vertical myoseptum disorganized, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 3 with image from Raeker et al., 2010
skeletal muscle cell myofibril decreased amount, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 4 with image from Raeker et al., 2010
eye decreased size, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
cardiac ventricle decreased size, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
skeletal muscle cell sarcomere structure, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 4 with image from Raeker et al., 2010
post-vent region decreased width, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 2 with image from Raeker et al., 2010
skeletal muscle cell Z disc structure, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 4 with image from Raeker et al., 2010
cardiac muscle cell structure, abnormal WT + MO3-obscnb + MO4-obscnb standard conditions Fig. 7 with image from Raeker et al., 2010
cardiac ventricle decreased size, abnormal twu34Tg + MO3-obscnb + MO4-obscnb standard conditions Fig. 6 with image from Raeker et al., 2010
heart contraction decreased rate, abnormal twu34Tg + MO3-obscnb + MO4-obscnb standard conditions Fig. 6 with image from Raeker et al., 2010
heart decreased functionality, abnormal twu34Tg + MO3-obscnb + MO4-obscnb standard conditions Fig. 6 with image from Raeker et al., 2010
heart dilated, abnormal twu34Tg + MO3-obscnb + MO4-obscnb standard conditions Fig. 6 with image from Raeker et al., 2010
pericardium edematous, abnormal twu34Tg + MO3-obscnb + MO4-obscnb standard conditions Fig. 6 with image from Raeker et al., 2010
Citations