Morpholino

MO1-cdk5

ID
ZDB-MRPHLNO-090106-1
Name
MO1-cdk5
Previous Names
  • cdk5-SMO (1)
Target
Sequence
5' - AGTGGCGTCTCTGACCTCAGCAGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splicing modification. Morpholino targets the exon3?intron3 boundary and results in a shorter mRNA.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdk5
No data available
Phenotype
Phenotype resulting from MO1-cdk5
Phenotype of all Fish created by or utilizing MO1-cdk5
Phenotype Fish Conditions Figures
retinal ganglion cell layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retina layer formation disrupted, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retinal inner nuclear layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
retinal outer plexiform layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
eye decreased size, abnormal AB + MO1-cdk5 standard conditions Fig. 3Fig. S2 from Leung et al., 2008
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-cdk5 standard conditions Fig. 3Fig. S2 from Leung et al., 2008
retina morphology, abnormal AB + MO1-cdk5 standard conditions Fig. S2 from Leung et al., 2008
whole organism decreased size, abnormal AB + MO1-cdk5 standard conditions Fig. S2 from Leung et al., 2008
retinal outer nuclear layer morphology, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
cranial nerve II aplastic, abnormal AB + MO1-cdk5 standard conditions Fig. 3 from Leung et al., 2008
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 standard conditions Fig. 3 with image from Tanaka et al., 2012
CaP motoneuron mislocalised, abnormal RW + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 3 from Morimura et al., 2013
Rohon-Beard neuron displaced to spinal cord axis, abnormal WT + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 3 with imageFig. 9 with image from Tanaka et al., 2012
neural crest cell displaced to spinal cord lateral margin, abnormal WT + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 10 with image from Tanaka et al., 2012
Rohon-Beard neuron displaced to spinal cord axis, abnormal rw011bTg + MO1-cdk5 + MO1-dyrk2 standard conditions Fig. 7 with image from Tanaka et al., 2012
Citations