Morpholino

MO1-mir9

ID
ZDB-MRPHLNO-081013-4
Name
MO1-mir9
Previous Names
  • dre-mir-9 MO (1)
  • MO1-mirn9 (1)
Targets
Sequence
5' - TCATACAGCTAGATAACCAAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 7 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir9
Expressed Gene Anatomy Figures
barhl2 Fig. 3 with image from Coolen et al., 2012
dusp6 Fig. 6 from Leucht et al., 2008
her4.1 Fig. 3 with image from Katz et al., 2016
mcm5 Fig. 2 with image from Katz et al., 2016
nr2e1 Fig. S4 with image from Madelaine et al., 2017
onecut1 Fig. S4 with image from Madelaine et al., 2017
onecut2 Fig. S4 with image from Madelaine et al., 2017
onecutl Fig. S4 with image from Madelaine et al., 2017
pcna Fig. 2 with image from Coolen et al., 2012
vegfaa Fig. 2 with image,  Fig. 3 with image from Madelaine et al., 2017
Phenotype
Phenotype resulting from MO1-mir9
No data available
Phenotype of all Fish created by or utilizing MO1-mir9
Phenotype Fish Conditions Figures
midbrain hindbrain boundary increased length, abnormal AB + MO1-mir9 standard conditions Fig. 6 from Leucht et al., 2008
midbrain hindbrain boundary increased width, abnormal AB + MO1-mir9 standard conditions Fig. 6 from Leucht et al., 2008
telencephalon ventricular zone her4.1 expression decreased amount, abnormal AB + MO1-mir9 control Fig. 3 with image from Katz et al., 2016
neuron differentiation disrupted, abnormal AB + MO1-mir9 standard conditions Fig. 7 from Leucht et al., 2008
brain onecut2 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
hindbrain lateral region has extra parts of type neuron, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
brain onecutl expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
retina nr2e1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
brain vegfaa expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. 2 with image,  Fig. 3 with image from Madelaine et al., 2017
hindbrain exit from mitosis delayed, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
hindbrain cell proliferation in hindbrain ventricular zone increased occurrence, abnormal WT + MO1-mir9 standard conditions Fig. 2 with image from Coolen et al., 2012
retina onecut1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
brain onecut1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
retina vegfaa expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
hindbrain neurogenesis increased occurrence, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
retina onecut2 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
retina onecutl expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
hindbrain neurogenesis increased duration, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
brain nr2e1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
brain vegfaa expression amount, ameliorated WT + MO1-mir9 + MO1-nr2e1 + MO1-onecutl standard conditions Fig. 3 with image from Madelaine et al., 2017
hindbrain lateral region has extra parts of type neuron, abnormal knu3Tg + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
hindbrain neurogenesis increased occurrence, abnormal knu3Tg + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
primordial hindbrain channel increased thickness, abnormal la116Tg + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts increased amount, abnormal la116Tg + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
primordial hindbrain channel endothelial cell increased amount, abnormal la116Tg + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
dorsal telencephalon neuronal stem cell division increased occurrence, abnormal mi2001Tg + MO1-mir9 standard conditions Fig. 2 with image from Katz et al., 2016
dorsal telencephalon stem cell proliferation increased occurrence, abnormal mi2001Tg + MO1-mir9 standard conditions Fig. 2 with image from Katz et al., 2016
radial glial cell nucleus Ab1-ago labeling decreased amount, abnormal mi2001Tg + MO1-mir9 control Fig. 4 with image from Katz et al., 2016
primordial hindbrain channel increased thickness, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts disorganized, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts decreased amount, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery decreased thickness, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
middle mesencephalic central artery malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
hindbrain blood vessel malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts amount, ameliorated s896Tg + MO1-mir9 chemical treatment by environment: semaxanib Fig. 2 with image from Madelaine et al., 2017
retina blood vessel decreased amount, abnormal s896Tg + MO1-mir9 standard conditions Fig. 6 with image from Madelaine et al., 2018
hyaloid vessel malformed, abnormal s896Tg + MO1-mir9 standard conditions Fig. 6 with image from Madelaine et al., 2018
brain blood vessel malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery disorganized, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
retina blood vessel malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.