Morpholino
MO1-nog1
- ID
- ZDB-MRPHLNO-080212-1
- Name
- MO1-nog1
- Previous Names
-
- MOa-nog1 (1)
- Target
- Sequence
-
5' - GCGGGAAATCCATCCTTTTGAAATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nog1
No data available
Phenotype
Phenotype resulting from MO1-nog1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-nog1
1 - 5 of 31 Show all
Citations
- Gao, M., Veil, M., Rosenblatt, M., Riesle, A.J., Gebhard, A., Hass, H., Buryanova, L., Yampolsky, L.Y., Grüning, B., Ulianov, S.V., Timmer, J., Onichtchouk, D. (2022) Pluripotency factors determine gene expression repertoire at zygotic genome activation. Nature communications. 13:788
- Tajer, B., Dutko, J.A., Little, S.C., Mullins, M.C. (2021) BMP heterodimers signal via distinct type I receptor class functions. Proceedings of the National Academy of Sciences of the United States of America. 118(15):
- Langdon, Y.G., Fuentes, R., Zhang, H., Abrams, E.W., Marlow, F.L., Mullins, M.C. (2016) Split top: A maternal cathepsin B that regulates dorsoventral patterning and morphogenesis. Development (Cambridge, England). 143(6):1016-28
- Kapp, L.D., Abrams, E.W., Marlow, F.L., and Mullins, M.C. (2013) The integrator complex subunit 6 (ints6) confines the dorsal organizer in vertebrate embryogenesis. PLoS Genetics. 9(10):e1003822
- Zhang, J.L., Patterson, L.J., Qiu, L.Y., Graziussi, D., Sebald, W., and Hammerschmidt, M. (2010) Binding between Crossveinless-2 and Chordin von Willebrand factor type C domains promotes BMP signaling by blocking Chordin activity. PLoS One. 5(9):e12846
- Dixon Fox, M., and Bruce, A.E. (2009) Short- and long-range functions of Goosecoid in zebrafish axis formation are independent of Chordin, Noggin 1 and Follistatin-like 1b. Development (Cambridge, England). 136(10):1675-1685
- Dal-Pra, S., Fürthauer, M., Van-Celst, J., Thisse, B., and Thisse, C. (2006) Noggin1 and Follistatin-like2 function redundantly to Chordin to antagonize BMP activity. Developmental Biology. 298(2):514-526
1 - 7 of 7
Show