Morpholino

MO1-nog1

ID
ZDB-MRPHLNO-080212-1
Name
MO1-nog1
Previous Names
  • MOa-nog1 (1)
Target
Sequence
5' - GCGGGAAATCCATCCTTTTGAAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nog1
No data available
Phenotype
Phenotype resulting from MO1-nog1
Phenotype of all Fish created by or utilizing MO1-nog1
Phenotype Fish Conditions Figures
telencephalon protruding, abnormal WT + MO1-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
extension decreased thickness, abnormal WT + MO1-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
cerebellum decreased size, abnormal WT + MO1-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
pharyngeal arch 3-7 skeleton aplastic, abnormal WT + MO1-nog1 standard conditions text only from Dal-Pra et al., 2006
Meckel's cartilage decreased size, abnormal WT + MO1-nog1 standard conditions text only from Dal-Pra et al., 2006
midbrain hindbrain boundary decreased thickness, abnormal WT + MO1-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
head agenesis, abnormal chrdtm84/tm84 + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal chrdtm84/tm84 + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal chrdtt250/tt250 + MO1-nog1 standard conditions Fig. S3 with image from Dixon Fox et al., 2009
head decreased size, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
neural plate decreased length, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
head anterior region truncated, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Zhang et al., 2010
Fig. 3 with imageFig. 7 with imageFig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
neural plate decreased thickness, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
otic vesicle mislocalised medially, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
otic vesicle decreased size, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
head anterior region agenesis, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-nog1 + MO1-szl standard conditions text only from Dal-Pra et al., 2006
whole organism cytolysis increased occurrence, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 2 with image from Kapp et al., 2013
Fig. 8 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal chrdtt250/tt250 + MO1-gsc + MO1-nog1 + MO5-fstl1b standard conditions Fig. S3 with image from Dixon Fox et al., 2009
whole organism wholly dorsalized, ameliorated ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism cytolysis increased occurrence, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal ints6p18ahub + MO1-chrd + MO1-fstl1b + MO1-nog1 (AB/TU) standard conditions Fig. 2 with image from Kapp et al., 2013
dorsal/ventral axis specification decreased process quality, abnormal pou5f3m793/+; sox19bm1434/+ + MO1-nog1 standard conditions Fig. 2 with image from Gao et al., 2022
dorsal/ventral axis specification decreased process quality, ameliorated pou5f3m793/+; sox19bm1434/+ + MO1-chrd + MO1-nog1 standard conditions Fig. 2 with image from Gao et al., 2022
Citations