ZFIN ID: ZDB-MRPHLNO-070122-1
Morpholino Name: MO2-obscnb
Target: obscnb (1)
Sequence:
5' - TGCTGCTTTCTTTCCCCCCTCAAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-obscnb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-obscnb No data available
PHENOTYPE
Phenotype resulting from MO2-obscnb
Phenotype Figures
cardiac muscle cell myofibril disorganized, abnormal Fig. 7 with image from Raeker et al., 2006
cardiac ventricle decreased size, abnormal Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
heart decreased size, abnormal Fig. 4 with image from Raeker et al., 2006
heart structure, abnormal Fig. 7 with image from Raeker et al., 2006
heart contraction decreased rate, abnormal Fig. 7 with image from Raeker et al., 2006
horizontal myoseptum aplastic, abnormal Fig. 6 with image from Raeker et al., 2006
pericardium edematous, abnormal Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
skeletal muscle cell elongated, abnormal Fig. 3 with image from Raeker et al., 2010
skeletal muscle cell myofibril disorganized, abnormal Fig. 4 with image from Raeker et al., 2010
Fig. 5 with imageFig. 6 with image from Raeker et al., 2006
skeletal muscle cell myofibril orientation skeletal muscle cell, abnormal Fig. 5 with image from Raeker et al., 2006
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal Fig. 5 with image from Raeker et al., 2010
Fig. 5 with image from Raeker et al., 2006
skeletal muscle cell striated muscle myosin thick filament disorganized, abnormal Fig. 5 with image from Raeker et al., 2006
striated muscle cell development disrupted, abnormal Fig. 4 with image from Raeker et al., 2006
vertical myoseptum decreased size, abnormal Fig. 6 with image from Raeker et al., 2006
vertical myoseptum disorganized, abnormal Fig. 3 with image from Raeker et al., 2010
vertical myoseptum morphology, abnormal Fig. 4 with image from Raeker et al., 2006
whole organism decreased length, abnormal Fig. 4 with image from Raeker et al., 2006

Phenotype of all Fish created by or utilizing MO2-obscnb
Phenotype Fish Conditions Figures
skeletal muscle cell myofibril disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with imageFig. 6 with image from Raeker et al., 2006
pericardium edematous, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
striated muscle cell development disrupted, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
heart structure, abnormal EKW + MO2-obscnb standard conditions Fig. 7 with image from Raeker et al., 2006
whole organism decreased length, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
heart contraction decreased rate, abnormal EKW + MO2-obscnb standard conditions Fig. 7 with image from Raeker et al., 2006
cardiac ventricle decreased size, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2006
vertical myoseptum decreased size, abnormal EKW + MO2-obscnb standard conditions Fig. 6 with image from Raeker et al., 2006
skeletal muscle cell striated muscle myosin thick filament disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2006
horizontal myoseptum aplastic, abnormal EKW + MO2-obscnb standard conditions Fig. 6 with image from Raeker et al., 2006
skeletal muscle cell myofibril orientation skeletal muscle cell, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2006
heart decreased size, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
cardiac muscle cell myofibril disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 7 with image from Raeker et al., 2006
vertical myoseptum morphology, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2010
vertical myoseptum disorganized, abnormal WT + MO2-obscnb standard conditions Fig. 3 with image from Raeker et al., 2010
skeletal muscle cell myofibril disorganized, abnormal WT + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2010
skeletal muscle cell elongated, abnormal WT + MO2-obscnb standard conditions Fig. 3 with image from Raeker et al., 2010
Genome Resources:
CITATIONS (3)