Morpholino

MO3-isl1a

ID
ZDB-MRPHLNO-060728-2
Name
MO3-isl1a
Previous Names
  • islet1E3 (1)
  • MO3-isl1
Target
Sequence
5' - GAATGCAATGCCTACCTGCCATTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-isl1a
No data available
Phenotype
Phenotype resulting from MO3-isl1a
Phenotype of all Fish created by or utilizing MO3-isl1a
Phenotype Fish Conditions Figures
motor neuron axon mislocalised posteriorly, abnormal AB + MO2-isl1a + MO3-isl1a standard conditions Fig. 4 with image from Hutchinson et al., 2006
VeLD increased amount, abnormal AB + MO2-isl1a + MO3-isl1a standard conditions Fig. 4 with image from Hutchinson et al., 2006
Kolmer-Agduhr neuron increased amount, abnormal AB + MO2-isl1a + MO3-isl1a standard conditions Fig. 4 with image from Hutchinson et al., 2006
secondary motor neuron decreased amount, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
MiP motor neuron axon absent, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 2 with image from Hutchinson et al., 2006
CaP motoneuron axon absent, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 2 with image from Hutchinson et al., 2006
secondary motor neuron axon decreased amount, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron axon disorganized, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
CaP motoneuron neuronal action potential process quality, abnormal WT + MO3-isl1a standard conditions Fig. 7 from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal WT + MO3-isl1a standard conditions Fig. 3 with image from Moreno et al., 2014
Rohon-Beard neuron neuronal action potential process quality, abnormal WT + MO3-isl1a standard conditions Fig. 8 from Moreno et al., 2014
CaP motoneuron membrane repolarization process quality, abnormal WT + MO3-isl1a standard conditions Fig. 7 from Moreno et al., 2014
CaP motoneuron neuron projection morphology, abnormal js12Tg + MO3-isl1a standard conditions Fig. 1 with image from Moreno et al., 2014
CaP motoneuron neuron projection displaced, abnormal js12Tg + MO3-isl1a standard conditions Fig. 1 with image from Moreno et al., 2014
CaP motoneuron neuronal action potential process quality, abnormal ml2Tg + MO3-isl1a standard conditions Fig. 4 from Moreno et al., 2014
primary motor neuron decreased amount, abnormal ml2Tg + MO3-isl1a standard conditions Fig. 2 with image from Moreno et al., 2014
CaP motoneuron neuron projection displaced, abnormal ml2Tg + MO3-isl1a standard conditions Fig. 1 with image from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal ml2Tg + MO3-isl1a standard conditions Fig. 2 with image from Moreno et al., 2014
CaP motoneuron neuron projection morphology, abnormal ml2Tg + MO3-isl1a standard conditions Fig. 1 with image from Moreno et al., 2014
Rohon-Beard neuron neuronal action potential process quality, abnormal sb4Tg + MO3-isl1a standard conditions Fig. 5 from Moreno et al., 2014
dorsal root ganglion decreased amount, abnormal sb4Tg + MO3-isl1a standard conditions Fig. 3 with image from Moreno et al., 2014
dorsal root ganglion neuron projection morphology, abnormal sb4Tg + MO3-isl1a standard conditions Fig. 3 with image from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal sb4Tg + MO3-isl1a standard conditions Fig. 2 with image from Moreno et al., 2014
spinal cord interneuron decreased amount, abnormal sb4Tg + MO3-isl1a standard conditions Fig. 2 with image from Moreno et al., 2014
Rohon-Beard neuron decreased amount, abnormal ym1Tg + MO3-isl1a standard conditions Fig. 6 with image from Moreno et al., 2014
secondary motor neuron absent, abnormal WT + MO1-isl2a + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
Citations